Acta Veterinaria et Zootechnica Sinica ›› 2024, Vol. 55 ›› Issue (9): 4100-4109.doi: 10.11843/j.issn.0366-6964.2024.09.034
• Basic Veterinary Medicine • Previous Articles Next Articles
Yiqian FU1,2,3(), Dongge LIANG1,2,3, Mingyang WANG1,2,3, Jiajia PAN1,2,3, Yanbin YANG1,2,3, Lei ZENG1,2,3,*(
), Xiangtao KANG4,*(
)
Received:
2023-11-14
Online:
2024-09-23
Published:
2024-09-27
Contact:
Lei ZENG, Xiangtao KANG
E-mail:1050223216@qq.com;zenglei2021918@163.com;xtkang2001@263.net
CLC Number:
Yiqian FU, Dongge LIANG, Mingyang WANG, Jiajia PAN, Yanbin YANG, Lei ZENG, Xiangtao KANG. Construction of Interferon Regulatory Factor Knockdown Cell Line and Its Effect on Pseudorabies Virus Proliferation[J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(9): 4100-4109.
Table 1
shRNA primer sequences"
名称 Name | 引物序列(5′→3′) Sequence |
shIRF-1 | CCGGGCTACACAGCTCAGGGATACACTCGAGTGTATCCCTGAGCTGTGTAGCTTTTTG AATTCAAAAAGCTACACAGCTCAGGGATACACTCGAGTGTATCCCTGAGCTGTGTAGC |
shIRF-2 | CCGGGCATCCATTCACACCGAATGCCTCGAGGCATTCGGTGTGAATGGATGCTTTTTG AATTCAAAAAGCATCCATTCACACCGAATGCCTCGAGGCATTCGGTGTGAATGGATGC |
shIRF-3 | CCGGGGAAAGAAGCATTGCGTTTAGCTCGAGCTAAACGCAATGCTTCTTTCCTTTTTG AATTCAAAAAGGAAAGAAGCATTGCGTTTAGCTCGAGCTAAACGCAATGCTTCTTTCC |
shIRF-4 | CCGGGCTTTATGCCAAGAGACTTTGCTCGAGCAAAGTCTCTTGGCATAAAGCTTTTTG AATTCAAAAAGCTTTATGCCAAGAGACTTTGCTCGAGCAAAGTCTCTTGGCATAAAGC |
shIRF-5 | CCGGGGACTTTCGCCTCATCTATGACTCGAGTCATAGATGAGGCGAAAGTCCTTTTTG AATTCAAAAAGGACTTTCGCCTCATCTATGACTCGAGTCATAGATGAGGCGAAAGTCC |
shIRF-8 | CCGGGGCTACGCTGTGCTTTGAACACTCGAGTGTTCAAAGCACAGCGTAGCCTTTTTG AATTCAAAAAGGCTACGCTGTGCTTTGAACACTCGAGTGTTCAAAGCACAGCGTAGCC |
Table 2
Primer sequences for RT-qPCR"
名称 Name | 引物序列(5′→3′) Sequence |
Q-β-actin-F | CTGAACCCCAAAGCCAACCGT |
Q-β-actin-R | TTCTCCTTGATGTCCCGCACG |
Q-gB-F | GGCATCGCCAACTTCTTCC |
Q-gB-R | CCTCGTCCACGTCGTCCTC |
Q-IFN-β-F | ATGATGGTGCCCTACACGCT |
Q-IFN-β-R | TCCACCTGCTCCGTCAGCCT |
Q-ISG-15-F | GGTGAGGAACGACAAGGGTC |
Q-ISG-15-R | GGCCTTGAGGTCATACTCCCC |
Q-IL-6-F | GCCTGAGGGCCATTCGGATA |
Q-IL-6-R | TGTGCCCAGTGGACAGGTTT |
Q-IRF1-F | ATCCTCTGCCTTCTCTTCGCT |
Q-IRF1-R | AGCCCTGGGATTTGGTTGGA |
Q-IRF2-F | AGGAAAGCATCAACCGGGAG |
Q-IRF2-R | TCCGGTATACCCTGAAGGCA |
Q-IRF3-F | AACCGGAAAGAAGCATTGCG |
Q-IRF3-R | GGTGTCTGGCTCAGGAAAGT |
Q-IRF4-F | TCCCAGCTCAGGTTCACAAC |
Q-IRF4-R | TGTCCCCTGGCAACCATTTTT |
Q-IRF5-F | GGCAGATGGATGGTCAAGACA |
Q-IRF5-R | ACTGGCATTCAGACCACCCT |
Q-IRF6-F | CCTCACCCCCGAAGAGTTC |
Q-IRF6-R | GAAGCGCTTGGAGTCTCTGT |
Q-IRF7-F | TCTACCCCCATCTGTGACCC |
Q-IRF7-R | AGGTGTTAACCGCAGGTGAG |
Q-IRF8-F | CAGCGGCTCAGGATGTGC |
Q-IRF8-R | CCGGAACATGCTCTTCTGGT |
Q-IRF9-F | ATCCTCCAGGACCCCTTCAA |
Q-IRF9-R | AACCCTACCTTCGGAGACT |
Fig. 1
Results of construction of the pLKO.1-shIRFs recombinant vector A. Electrophoresis results of double digestion products of pLKO.1 vector (Marker. Molecular weight standard of DNA marker DL15000); B. Electrophoresis results of PCR amplification products of bacterial broth after transformation with pLKO.1-shIRFs recombinant vector (Marker. Molecular weight standard of DNA marker DL2000); C. pLKO.1-shIRFs recombinant vector after transformation of bacterial liquid sequencing results, the dark region is shIRFs sequence"
Fig. 2
Validation of knockdown efficiency in PK15 shIRFs knockdown cell lines A. RT-qPCR analysis of IRFs gene transcript levels in knockdown cell lines, *.P < 0.05, **.P < 0.001, ***.P < 0.000 1; B. Western blot analysis of IRF-3 protein expression levels in PK15 shIRF-3 cells; C. Immunofluorescence assay was performed to detect the expression level of IRF-3 protein in PK15 shIRF-3 cells"
Fig. 3
The effect of IRFs gene knockdown on PRV replication in PK15 cells was verified A. Fluorescence imaging to observe the fluorescence intensity in PK15 control and PK15 shIRFs cells after infection with PRV-GFP.B. Flow cytometry to detect the proportion of cells with fluorescence in PK15 control and PK15 shIRFs cells after infection with PRV-GFP.C. Plaque assay to determine the titer of progeny virus in PK15 control and PK15 shIRFs cells after infection with PRV-QXX.D. RT-qPCR to measure the transcription level of the PRV-gB gene in PK15 control and PK15 shIRFs cells after infection with PRV-QXX.E. Western blot to assess the protein expression level of PRV-gB in PK15 control and PK15 shIRFs cells after infection with PRV-QXX. *.P < 0.05, **.P < 0.001, ***.P < 0.000 1"
Fig. 4
The effect of IRFs knockdown on the transcription level of inflammatory factors was verified A. RT-qPCR was used to detect the transcriptional levels of IFN-β in the presence of PRV-QXX infection after IRFs knockdown; B. RT-qPCR was used to detect ISG-15 transcript levels in the presence of PRV-QXX infection after IRFs knockdown; C. RT-qPCR was used to detect the transcriptional levels of IL-6 in the presence of PRV-QXX infection after IRFs knockdown. *.P < 0.05, **.P < 0.001, ***.P < 0.000 1, ns. P>0.05"
1 |
POMERANZ L E , REYNOLDS A E , HENGARTNER C J . Molecular biology of pseudorabies virus: impact on neurovirology and veterinary medicine[J]. Microbiol Mol Biol Rev, 2005, 69 (3): 462- 500.
doi: 10.1128/MMBR.69.3.462-500.2005 |
2 | WITTMANN G, RZIHA H J. Aujeszky's disease (Pseudorabies) in pigs[M]//WITTMANN G. Herpesvirus Diseases of Cattle, Horses, and Pigs. New York: Springer, 1989: 230-325. |
3 | 袁庆志, 吴裕祥, 李亚香, 等. 伪狂犬病免疫的研究: Ⅰ伪狂犬病弱毒疫苗的研究[J]. 家畜传染病, 1983, (1): 1- 6. |
YUAN Q Z , WU Y X , LI Y X , et al. The pseudorabies vaccination research. Ⅰ: Pseudorabies attenuated vaccine research[J]. Chinese Journal of Preventive Veterinary Medicine, 1983, (1): 1- 6. | |
4 | METTENLEITER T C . Aujeszky's disease (pseudorabies) virus: the virus and molecular pathogenesis—State of the art, June 1999[J]. Vet Res, 2000, 31 (1): 99- 115. |
5 |
LAVAL K , ENQUIST L W . The neuropathic itch caused by pseudorabies virus[J]. Pathogens, 2020, 9 (4): 254.
doi: 10.3390/pathogens9040254 |
6 |
MVLLER T , HAHN E C , TOTTEWITZ F , et al. Pseudorabies virus in wild swine: a global perspective[J]. Arch Virol, 2011, 156 (10): 1691- 1705.
doi: 10.1007/s00705-011-1080-2 |
7 |
WONG G , LU J H , ZHANG W H , et al. Pseudorabies virus: a neglected zoonotic pathogen in humans?[J]. Emerg Microbes Infect, 2019, 8 (1): 150- 154.
doi: 10.1080/22221751.2018.1563459 |
8 |
BO Z Y , LI X D . A review of pseudorabies virus variants: genomics, vaccination, transmission, and zoonotic potential[J]. Viruses, 2022, 14 (5): 1003.
doi: 10.3390/v14051003 |
9 |
MASIĆ M , ERCEGAN M , PETROVIĆ M . The significance of the tonsils in the pathogenesis and diagnosis of Aujeszyk's disease in pigs[J]. Zentralbl Veterinarmed B, 1965, 12 (5): 398- 405.
doi: 10.1111/j.1439-0450.1965.tb01403.x |
10 |
TIRABASSI R S , TOWNLEY R A , ELDRIDGE M G , et al. Molecular mechanisms of neurotropic herpesvirus invasion and spread in the CNS[J]. Neurosci Biobehav Rev, 1998, 22 (6): 709- 720.
doi: 10.1016/S0149-7634(98)00009-8 |
11 | GUTEKUNST D E , PIRTLE E C , MILLER L D , et al. Isolation of pseudorabies virus from trigeminal ganglia of a latently infected sow[J]. Am J Vet Res, 1980, 41 (8): 1315- 1316. |
12 |
AKIRA S , UEMATSU S , TAKEUCHI O . Pathogen recognition and innate immunity[J]. Cell, 2006, 124 (4): 783- 801.
doi: 10.1016/j.cell.2006.02.015 |
13 |
YE G Q , LIU H Y , ZHOU Q Q , et al. A tug of war: pseudorabies virus and host antiviral innate immunity[J]. Viruses, 2022, 14 (3): 547.
doi: 10.3390/v14030547 |
14 |
TAMURA T , YANAI H , SAVITSKY D , et al. The IRF family transcription factors in immunity and oncogenesis[J]. Annu Rev Immunol, 2008, 26, 535- 584.
doi: 10.1146/annurev.immunol.26.021607.090400 |
15 |
FUJITA T , SAKAKIBARA J , SUDO Y , et al. Evidence for a nuclear factor(s), IRF-1, mediating induction and silencing properties to human IFN-beta gene regulatory elements[J]. EMBO J, 1988, 7 (11): 3397- 3405.
doi: 10.1002/j.1460-2075.1988.tb03213.x |
16 |
MIYAMOTO M , FUJITA T , KIMURA Y , et al. Regulated expression of a gene encoding a nuclear factor, IRF-1, that specifically binds to IFN-β gene regulatory elements[J]. Cell, 1988, 54 (6): 903- 913.
doi: 10.1016/S0092-8674(88)91307-4 |
17 |
SUZUKI Y , YASUIKE M , KONDO H , et al. Molecular cloning and expression analysis of interferon regulatory factor 10 (IRF10) in Japanese flounder, Paralichthys olivaceus[J]. Fish Shellfish Immunol, 2011, 30 (1): 67- 76.
doi: 10.1016/j.fsi.2010.09.010 |
18 |
ANTONCZYK A , KRIST B , SAJEK M , et al. Direct inhibition of IRF-dependent transcriptional regulatory mechanisms associated with disease[J]. Front Immunol, 2019, 10, 1176.
doi: 10.3389/fimmu.2019.01176 |
19 |
XU D S , MEYER F , EHLERS E , et al. Interferon regulatory factor 4 (IRF-4) targets IRF-5 to regulate Epstein-Barr virus transformation[J]. J Biol Chem, 2011, 286 (20): 18261- 18267.
doi: 10.1074/jbc.M110.210542 |
20 |
ZHANG X W , ZHENG Z H , LIU X J , et al. Tick-borne encephalitis virus induces chemokine RANTES expression via activation of IRF-3 pathway[J]. J Neuroinflammation, 2016, 13 (1): 209.
doi: 10.1186/s12974-016-0665-9 |
21 |
HEYLBROECK C , BALACHANDRAN S , SERVANT M J , et al. The IRF-3 transcription factor mediates Sendai virus-induced apoptosis[J]. J Virol, 2000, 74 (8): 3781- 3792.
doi: 10.1128/JVI.74.8.3781-3792.2000 |
22 |
XU Q Q , CHANG M X , XIAO F S , et al. The gene and virus-induced expression of IRF-5 in grass carp Ctenopharyngodon idella[J]. Vet Immunol Immunopathol, 2010, 134 (3-4): 269- 278.
doi: 10.1016/j.vetimm.2009.10.020 |
23 |
LIU H M , LI C , HE W F , et al. Free ISG15 inhibits pseudorabies virus infection by positively regulating type Ⅰ IFN signaling[J]. PLoS Pathog, 2022, 18 (10): e1010921.
doi: 10.1371/journal.ppat.1010921 |
24 | DELVA J L , VAN WAESBERGHE C , VAN DEN BROECK W , et al. The attenuated pseudorabies virus vaccine strain Bartha Hyperactivates Plasmacytoid dendritic cells by generating large amounts of cell-free virus in infected epithelial cells[J]. J Virol, 2022, 96 (12): e02199- 21. |
25 |
DAI J H , MEGJUGORAC N J , AMRUTE S B , et al. Regulation of IFN regulatory factor-7 and IFN-α production by enveloped virus and lipopolysaccharide in human plasmacytoid dendritic cells[J]. J Immunol, 2004, 173 (3): 1535- 1548.
doi: 10.4049/jimmunol.173.3.1535 |
[1] | WANG Mengdi, WANG Yumin, ZHANG Zhen, LU Xiuxiang, WANG Heng, FAN Wenjie, YAO Chen, LIU Pengxiang, MA Yanjie, CHU Beibei, WANG Jiang, YANG Guoyu. Effect of TSG101 Gene Knockdown on Proliferation of Pseudorabies Virus in vitro [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(9): 4110-4120. |
[2] | Huihui GUO, Hao ZHAGN, Dan YANG, Yan KUANG, Yafei LI, Shaomeng LIU, Qingyun LIU, Xiangru WANG. Construction of Fluorescently Labelled Pseudorabies Viruses and Their Preliminary Application in Antiviral Drug Screening [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(8): 3600-3611. |
[3] | ZHANG Ying, SONG Chunlian, ZHANG Ying, SHEN Hong, SHU Xianghua, YANG Honggui. Study on the Damage of Blood-brain Barrier by Tight Junction Protein Mediated by MMP-9 in Pseudorabies Virus-infected Mice [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(5): 2186-2194. |
[4] | LI Yixuan, NIU Jingyi, LI Gang, WAN Chao, FANG Rendong, YE Chao. Research Progress on the Biological Functions of Tegument Proteins Encoded by Pseudorabies Virus [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(3): 957-970. |
[5] | CHEN Hongjian, CAO Yan, FAN Jie, GAN Rongxuan, SONG Wenbo, YU Shengwei, YANG Ting, ZHAO Yanxia, WEI Chunyan, XIE Rui, HUA Lin, PENG Zhong, WU Bin. Prevalence and Phylogenetic Analysis of Pseudorabies Virus within Pig Slaughterhouses in Hubei Province of China during 2020-2022 [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(7): 2972-2981. |
[6] | YUAN Sheng, LI Anqi, Lü Wenke, YANG Lulu, ZHOU Feng, HUANG Liangzong, BAI Aiquan, WEN Feng, HUANG Shujian, GUO Jinyue. Analysis of Variation in Major Virulence-related Genes of a Strain of Pseudorabies Virus and Its Pathogenicity to Rabbits [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(5): 2195-2199. |
[7] | LIU Yankun, LUO Runbo, LIN Yan, ZHU Weiyun. Effects of Phage Cocktail on Growth Performance, Blood Parameters and Fecal Microbiota of Weaned Piglets [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(4): 1555-1567. |
[8] | NI Zheng, YE Weicheng, CHEN Liu, YUN Tao, HUA Jionggang, ZHU Yinchu, ZHANG Cun. Genetic Variation and Pathogenicity of a Pseudorabies Virus Variant Strain in Mice [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(4): 1766-1770. |
[9] | WU Xuemin, CHEN Rujing, CHEN Qiuyong, CHE Yongliang, YAN Shan, LIU Yutao, ZHOU Lunjiang, WANG Longbai. Establishment and Preliminary Application of Indirect ELISA for Detection of Variant Pseudorabies Virus gC Antibody [J]. Acta Veterinaria et Zootechnica Sinica, 2022, 53(6): 2029-2034. |
[10] | LI Zhaolong, ZHANG Huifang, FENG Zhihua, FANG Zhou. Therapeutic Effect of Recombinant Adeno-Associated Virus Carrying CRISPR/Cas9 on Pseudorabies Virus-infected Mice [J]. Acta Veterinaria et Zootechnica Sinica, 2022, 53(3): 834-846. |
[11] | CHEN Danian, MA Xusheng, DAI Junfei, WANG Yang, LI Qian, BAI Heng, MAO Tiantian, LIU Yongsheng, DING Long, CHEN Haohan, CHEN Siyan, RAO Yufei, JIA Ning, ZHANG Jie, ZHENG Haixue, LIU Xiangtao. Preliminary Study on the Function of MGF360-13L Gene of African Swine Fever Virus Multigene Family [J]. Acta Veterinaria et Zootechnica Sinica, 2022, 53(12): 4419-4428. |
[12] | GUO Zhenhua, LI Xiang, WENG Maoyang, JIN Qianyue, GUO Junqing, XING Guangxu, ZHANG Gaiping. Host Annexin A2 Interacts with US3 of PRV and Its Effects on Apoptosis [J]. Acta Veterinaria et Zootechnica Sinica, 2022, 53(11): 3927-3935. |
[13] | WANG Jiamin, LI Ziliang, MA Fangfang, KANG Bijing, TIAN Ling, LI Zhuo, MA Zhongren, QIAO Zilin. Optimization of BHK-21 Suspension Cells to Propagate Pseudorabies Virus in Bioreactor [J]. Acta Veterinaria et Zootechnica Sinica, 2022, 53(11): 3936-3947. |
[14] | LI Chen, HE Wenfeng, ZHAO Lina, FAN Qi, YANG Guoqing, LIU Huimin. Effect of Interferon Stimulated Gene 15 Knockout in PK-15 Cell Line on Replication of Pseudorabies Virus [J]. Acta Veterinaria et Zootechnica Sinica, 2022, 53(10): 3621-3630. |
[15] | ZHAI Yunyun, LI Jiajia, ZHANG Shuang, REN Ziyu, JIN Qianyue, DU Yongkun, WAN Bo. Establishment of Apoptosis Associated Dot Like Protein Knockout PK-15 Cell Line and Its Effect on Porcine Pseudorabies Virus Infection [J]. Acta Veterinaria et Zootechnica Sinica, 2021, 52(2): 478-487. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||