lncRNA PFN1-AS1在奶牛乳腺上皮细胞炎症反应中的作用

doi:10.11843/j.issn.0366-6964.2025.11.043

Abstract

Abstract:

Studies have shown that long non-coding RNA (lncRNA) is differentially expressed in dairy cow mastitis, but the molecular mechanisms by which it regulates dairy cow mastitis are unknown. The aim of this study was to investigate the role of lncRNA TCONS_00062289 in the inflammatory response of bovine mammary epithelial cells (bMECs). The lncRNA was named lncRNA PFN1-AS1 because of its sequence identity with the actin monomer-binding protein antisense (PFN1-AS1). LncRNA PFN1-AS1 was cloned by RT-PCR and its function was predicted. Inflammatory cell modeling with lipopolysaccharides (LPS) induced bMECs, in order to explore the effect of interfering lncRNA PFN1-AS1 on cell inflammation, proliferation and apoptosis in the inflammatory model. The lncRNA PFN1-AS1 is 811 bp in length, may be involved in the regulation of apoptosis and inflammatory processes. LncRNA PFN1-AS1 mainly distributed in the cytoplasm. In the LPS-induced inflammation model of bMECs, the expression level of lncRNA PFN1-AS1 was significantly down-regulated (P < 0.05). After interfering with lncRNA PFN1-AS1, the mRNA expression and protein secretion level of pro-inflammatory cytokines interleukin (IL) -6, IL-8 and IL-1β were significantly up-regulated (P < 0.05). The expression level of cyclin dependent kinase2 (CDK2), CDK4 and proliferating cell nuclear antigen (PCNA) were significantly down-regulated (P < 0.05), and the cell viability value and proliferation rate were significantly decreased (P < 0.05); the expression level of cysteinyl aspartate specific proteinase (CASP3), CASP8 and bcl-2-associated X protein (BAX) were significantly up-regulated (P < 0.05), and the rate of apoptosis was highly significantly increased (P < 0.01). Interference with lncRNA PFN1-AS1 promoted the transcription and protein secretion of IL-6, IL-8, and IL-1β, promoted the level of apoptosis, and decreased the cell viability and proliferation. These results reveal the role of lncRNA PFN1-AS1 in the inflammation of bMECs, and provide a scientific basis for further investigation of its role in mastitis of dairy cows.

Key words: bovine mammary epithelial cells, lncRNA PFN1-AS1, lipopolysaccharides, inflammatory

CLC Number:

S857.26

HU Ximin, LUORENG Zhuoma, ZHOU Ran, LI Yuhang, WANG Xingping. Role of lncRNA PFN1-AS1 in the Inflammatory Response of Bovine Mammary Epithelial Cells[J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(11): 5875-5887.

Figures/Tables 10

Table 1

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Fig. 6

Fig. 7

Fig. 8

Fig. 9

References 34

1	HE W , MA S , LEI L , et al. Prevalence, etiology, and economic impact of clinical mastitis on large dairy farms in China[J]. Vet Microbiol, 2020, 242, 108570. doi: 10.1016/j.vetmic.2019.108570
2	GAO J , BARKEMA H W , ZHANG L , et al. Incidence of clinical mastitis and distribution of pathogens on large Chinese dairy farms[J]. J Dairy Sci, 2017, 100 (6): 4797- 4806. doi: 10.3168/jds.2016-12334
3	ZHOU M , YANG Y , WU M , et al. Role of long polar fimbriae type 1 and 2 in pathogenesis of mammary pathogenic Escherichia coli[J]. J Dairy Sci, 2021, 104 (7): 8243- 8255. doi: 10.3168/jds.2021-20122
4	DOGAN B , KLAESSIG S , RISHNIW M , et al. Adherent and invasive Escherichia coli are associated with persistent bovine mastitis[J]. Vet Microbiol, 2006, 116 (4): 270- 282. doi: 10.1016/j.vetmic.2006.04.023
5	GILBERT F B , CUNHA P , JENSEN K , et al. Differential response of bovine mammary epithelial cells to Staphylococcus aureus or Escherichia coli agonists of the innate immune system[J]. Vet Res, 2013, 44 (1): 40- 63. doi: 10.1186/1297-9716-44-40
6	GONEN E , VALLON-EBERHARD A , ELAZAR S , et al. Toll-like receptor 4 is needed to restrict the invasion of Escherichia coli P4 into mammary gland epithelial cells in a murine model of acute mastitis[J]. Cell Microbiol, 2007, 9 (12): 2826- 2838. doi: 10.1111/j.1462-5822.2007.00999.x
7	CORNUT M , BOURDONNAY E , HENRY T . Transcriptional regulation of inflammasomes[J]. Int J Mol Sci, 2020, 21 (21): 8087. doi: 10.3390/ijms21218087
8	GOULART D B , MELLATA M . Escherichia coli mastitis in dairy cattle: Etiology, diagnosis, and treatment challenges[J]. Front Microbiol, 2022, 13, 928346. doi: 10.3389/fmicb.2022.928346
9	XIA X , HOU J , REN P , et al. Coexpression analysis of lncRNAs and mRNAs identifies potential regulatory long noncoding RNAs involved in the inflammatory effects of lipopolysaccharide on bovine mammary epithelial cells[J]. BMC Vet Res, 2023, 19 (1): 209- 221. doi: 10.1186/s12917-023-03780-4
10	LUO H , XU C , LE W , et al. lncRNA CASC11 promotes cancer cell proliferation in bladder cancer through miRNA-150[J]. J Cell Biochem, 2019, 120 (8): 13487- 13493. doi: 10.1002/jcb.28622
11	YAN L , WU X , ZHANG Y , et al. LncRNA ENST00000370438 promotes cell proliferation by upregulating DHCR24 in breast cancer[J]. Mol Carcinog, 2023, 62 (6): 855- 865. doi: 10.1002/mc.23529
12	WANG J P , HU Q C , YANG J , et al. Differential expression profiles of lncRNA following LPS-induced inflammation in bovine mammary epithelial cells[J]. Front Vet Sci, 2021, 8, 758488. doi: 10.3389/fvets.2021.758488
13	WANG D , YANG H , MA S , et al. Transcriptomic changes and regulatory networks associated with resistance to mastitis in Xinjiang brown cattle[J]. Genes (Basel), 2024, 15 (4): 465- 483. doi: 10.3390/genes15040465
14	WANG J , WANG X , FENG F , et al. LncRNA HULIB promotes LPS induced inflammatory response in bovine mammary epithelial cells via PP2AB[J]. Int Immunopharmacol, 2024, 143 (Pt 3): 113496.
15	CHU S , ZHAO T , LI M , et al. Long non-coding RNA (CMR) involved in autoprotection in S. aureus mastitis in dairy cows by regulating miR-877/FOXM1[J]. Ecotoxicol Environ Saf, 2024, 278, 116456. doi: 10.1016/j.ecoenv.2024.116456
16	SUN Y , ZHAO T , MA Y , et al. Multiple roles of LncRNA-BMNCR on cell proliferation and apoptosis by targeting miR-145/CBFB axis in BMECs[J]. Vet Q, 2023, 43 (1): 1- 11.
17	YANG J , HU Q C , WANG J P , et al. RNA-Seq reveals the role of miR-29c in regulating inflammation and oxidative stress of bovine mammary epithelial cells[J]. Front Vet Sci, 2022, 9, 865415. doi: 10.3389/fvets.2022.865415
18	FENG F , LI Y , WANG J , et al. LncRNA CA12-AS1 targets miR-133a to promote LPS-induced inflammatory response in bovine mammary epithelial cells[J]. Int J Biol Macromol, 2024, 261 (Pt 1): 129710.
19	王晋鹏, 罗仍卓么, 李彦霞, 等. lncRNA RRAS2-AS1在LPS诱导奶牛乳腺上皮细胞炎症中的功能[J]. 中国农业科学, 2024, 57 (14): 2874- 2891.
	WANG J P , LUORENG Z M , LI Y X , et al. Function of lncRNA RRAS2-AS1 in LPS-induced inflammation of bovine mammary epithelial cells[J]. Chinese Journal of Agricultural Sciences, 2024, 57 (14): 2874- 2891.
20	LI Y , REN Q , WANG X , et al. Bta-miR-199a-3p Inhibits LPS-induced inflammation in bovine mammary epithelial cells via the PI3K/AKT/NF-kappa B signaling pathway[J]. Cells, 2022, 11 (21): 3518- 3532. doi: 10.3390/cells11213518
21	LI R , FANG H , SHEN J , et al. Curcumin alleviates LPS-induced oxidative stress, inflammation and apoptosis in bovine mammary epithelial cells via the NFE2L2 signaling pathway[J]. Toxins (Basel), 2021, 13 (3): 1- 15.
22	LIU J , GAO Y , ZHANG X , et al. Transcriptome sequencing analysis of bovine mammary epithelial cells induced by lipopolysaccharide[J]. Anim Biotechnol, 2024, 35 (1): 2290527. doi: 10.1080/10495398.2023.2290527
23	LIN T , BAI X , GAO Y , et al. CTH/H (2) S regulates LPS-induced inflammation through IL-8 signaling in MAC-T cells[J]. Int J Mol Sci, 2022, 23 (19): 11822. doi: 10.3390/ijms231911822
24	LAI Y C , FUJIKAWA T , MAEMURA T , et al. Inflammation-related microRNA expression level in the bovine milk is affected by mastitis[J]. PLoS One, 2017, 12 (5): e0177182. doi: 10.1371/journal.pone.0177182
25	SRIKOK S , PATCHANEE P , BOONYAYATRA S , et al. Potential role of microRNA as a diagnostic tool in the detection of bovine mastitis[J]. Prev Vet Med, 2020, 182, 105101. doi: 10.1016/j.prevetmed.2020.105101
26	JIA L , WANG J , LUORENG Z , et al. Progress in expression pattern and molecular regulation mechanism of lncRNA in bovine mastitis[J]. Animals (Basel), 2022, 12 (9): 1059- 1070.
27	WANG H , WANG X , LI X , et al. A novel long non-coding RNA regulates the immune response in MAC-T cells and contributes to bovine mastitis[J]. FEBS J, 2019, 286 (9): 1780- 1795. doi: 10.1111/febs.14783
28	YANG W , LI X , QI S , et al. lncRNA H19 is involved in TGF-beta1-induced epithelial to mesenchymal transition in bovine epithelial cells through PI3K/AKT signaling pathway[J]. PeerJ, 2017, 5, e3950. doi: 10.7717/peerj.3950
29	LI X , WANG H , ZHANG Y , et al. Overexpression of lncRNA H19 changes basic characteristics and affects immune response of bovine mammary epithelial cells[J]. PeerJ, 2019, 7, e6715. doi: 10.7717/peerj.6715
30	YI Y , YANG N , YANG Z , et al. LncRNA TM1-3P regulates proliferation, apoptosis and inflammation of fibroblasts in osteoarthritis through miR-144-3p/ONECUT2 axis[J]. Orthop Surg, 2022, 14 (11): 3078- 3091. doi: 10.1111/os.13530
31	KLEC C , PRINZ F , PICHLER M . Involvement of the long noncoding RNA NEAT1 in carcinogenesis[J]. Mol Oncol, 2019, 13 (1): 46- 60. doi: 10.1002/1878-0261.12404
32	MA J , ZHAO N , DU L , et al. Downregulation of lncRNA NEAT1 inhibits mouse mesangial cell proliferation, fibrosis, and inflammation but promotes apoptosis in diabetic nephropathy[J]. Int J Clin Exp Pathol, 2019, 12 (4): 1174- 1183.
33	WANG L , QU P , YIN W , et al. Lnc-NEAT1 induces cell apoptosis and inflammation but inhibits proliferation in a cellular model of hepatic ischemia/reperfusion injury[J]. J Int Med Res, 2021, 49 (3): 1- 11.
34	LU J , GU B , LU W , et al. Lnc-ANRIL modulates the immune response associated with NF-kappaB pathway in LPS-stimulated bovine mammary epithelial cells[J]. Immun Inflamm Dis, 2023, 11 (12): e1125. doi: 10.1002/iid3.1125

基因名 Gene name	基因登录号 GenBank ID	引物序列(5′→3′) Primer sequences	产物长度/bp Product length
lncRNAPFN1-AS1	PQ628053	F: GAATAAAGCCCGCCCTAG R: GAGTGCCTGCCAATCATACA	187
IL-6	NM_173923	F: CACTCCATTCGCTGTCT R: GTGTCTCCTTGCTGCTT	227
IL-8	NM_173925.2	F: ACACATTCCACACCTTTCCAC R: ACCTTCTGCACCCACTTTTC	149
IL-1β	NM_174093.1	F: CAACCGTACCTGAACCC R: GACACCACCTGCCTGAA	110
CDK2	NM_001014934	F: GATGGACGGAGCTTGTTATCG R: ATCACACTCACACTGGAGAAGA	182
CDK4	NM_001037594.2	F: CCTTCATGCCAACTGCATCG R: CCAGAGTGTAACAACCACAGGT	168
PCNA	NM_001034494.1	F: GAACCTCACCAGCATGTCCA R: ACGTGTCCGCGTTATCTTCA	86
CASP3	NM_001077840.1	F: AAGATTTAGTGCCGATGC R: GACCACCAAGTTCTAGGATA	175
CASP8	NM_001045970.2	F: TCACCCACGGAAACAAGG R: TCGGTCTCAACGGCTACAC	178
BAX	NM_173894.1	F: GCAAACTGGTGCTCAAGG R: GCACTCCAGCCACAAAGA	189
GAPDH	NM_001034034.2	F: GGCATCGTGGAGGGACTTATG R: CCAGTGAGCTTCCCGTTGAG	186
RPS18	NM_001033614.2	F: GTGGTGTTGAGGAAAGCAGACA R: TGATCACACGTTCCACCTCATC	79
U6	NM_001075477.2	F: GCTTCGGCAGCACATATACTAAAAT R: CGCTTCACGAATTTGCGTGTCAT	89

[1]	WEN Xue, XU Wanxue, FU Yitong, YANG Jie, FU Hongyu, FAN Ruifeng. Research Progress on the Relationship between Ferroptosis and Inflammation [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(8): 3666-3677.
[2]	LI Xiaodie, PAN Shiqin, WANG Lu, CHENG Zhentao, OU Deyuan, SONG Xuqin, YANG Jian. Research Progress on the Anti-inflammatory Mechanism of Traditional Chinese Veterinary Medicine based on Network Pharmacology [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(8): 3701-3721.
[3]	ZHANG Chenmiao, CHEN Bowen, JIANG Linshu, TONG Jinjin. Potential Applications of Nanotechnology-Improved Flavonoids in Animal Health Management [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(7): 3107-3115.
[4]	GAO Linna, JIANG Yingying, WANG Yue, SHI Qianqian, AN Zhenjiang, WANG Huili, SHEN Yangyang, CHEN Kunlin, ZHANG Leying. Construction of a Whole Genome Knockout Library of bMECs Based on CRISPR/Cas9 Technology [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(6): 2711-2723.
[5]	LUO Shishi, CHEN Beilei, ZHANG Lei, FENG Qixian, WU Ruisen, CHEN Jiaqi, WANG Yuan, JIAN Zixin, XU Lihui, CHEN Qiuyong, MA Yufang, WANG Quanxi. Radix Pseudostellariae Polysaccharide Regulates Let-7d-3p to Alleviates Inflammatory-induced by Pseudorabies Virus Infection in Mice [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(5): 2438-2450.
[6]	CHEN Zehan, ZHANG Ruoyi, LIN Huiying, ZENG Chunli, LIN Fu, LI Jian. Anti-inflammatory Effects of Chelidonium majus on IPEC-J2 Cells based on HPLC Fingerprint and Network Pharmacology [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(5): 2466-2480.
[7]	ZHAO Ying, WANG Jinglei, WANG Meng, WANG Libin, ZHANG Qian, LI Zhijie, MA Xin, YU Sijiu, PAN Yangyang. Preparation and Characterization of Forsythiaside A and Kaempferol Encapsulated in Milk-derived Exosomes and Evaluation of Anti-inflammatory Effects in vitro [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(5): 2481-2495.
[8]	ZHANG Xiwen, YIN Yue, LI Xiang, WANG Min, WANG Yongfang, JIN Shuning, FENG Xinhui, ZHAO Yurong. Effects of Ursolic Acid on Breast Meat Quality and Wooden Breast of Broilers [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(2): 711-721.
[9]	LI Fan, SUN Haifeng, SUN Meng, GAO Yanxiao, SUN Yangyang, ZHANG Lujie, BAI Juan, JIANG Ping. Preparation and Anti-inflammatory Activity of Porcine IL-1β Monoclonal Antibody [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(2): 890-899.
[10]	LI Xinke, YANG Xue, ZHANG Xuan, MENG Lu, ZHANG Yangdong, WANG Jiaqi, ZHENG Nan. Effects of Short-Chain Fatty Acids on Liver and Brain Development and Immune Function in Neonatal Mice [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(11): 5588-5599.
[11]	MA Yue, MIAO Yuhang, DING Tao, XIN Jie, MA Wenyan, LI Yanan, ZHOU Xuezhang, DU Jun. Signaling Pathway Analysis of Ferroptosis Induced by Recombinant Candida krusei 14-3-3 Protein in Bovine Mammary Epithelial Cells [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(11): 5706-5720.
[12]	WANG Hengtai, JIANG Hui, LI Peng, DING Jiabo. Biosynthesis of Brucella Lipopolysaccharides and Their Biological Functions in Immune Evasion [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(10): 4863-4876.
[13]	Yiqian FU, Dongge LIANG, Mingyang WANG, Jiajia PAN, Yanbin YANG, Lei ZENG, Xiangtao KANG. Construction of Interferon Regulatory Factor Knockdown Cell Line and Its Effect on Pseudorabies Virus Proliferation [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(9): 4100-4109.
[14]	Ling LIU, Wanyu SHI, Xiumei LI, Minghua WANG, Xianghe ZHAI, Weiwei ZHOU. Intervention of Essential Oils from Citrus reticulata Blanco on Lipopolysaccharide- induced Inflammation in RAW264.7 Cells [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(9): 4153-4160.
[15]	Ya’nan LI, Tianwen MA, Yuhui MA, Chengwei WEI. Bilobalide Regulates Mitochondrial Biogenesis Mediated by AMPK-SIRT3 Positive Feedback Loop and Improves Inflammatory Damage of ATDC5 Chondrocytes [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(8): 3714-3724.

Role of lncRNA PFN1-AS1 in the Inflammatory Response of Bovine Mammary Epithelial Cells

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 10

References 34

Related Articles 15

Recommended Articles

Metrics

Comments