

Acta Veterinaria et Zootechnica Sinica ›› 2025, Vol. 56 ›› Issue (9): 4328-4340.doi: 10.11843/j.issn.0366-6964.2025.09.017
• Animal Genetics and Breeding • Previous Articles Next Articles
WANG Congliang1(
), WAN Shicheng1(
), CHEN Wenbo1, LI Jiannan1, SONG Yanfeng2, DU Xiaomin2, LIU Wangye3, LI Rongrong3, LEI Anmin1, QU Lei2, ZHU Haijing2,*(
), HUA Jinlian1,*(
)
Received:2025-02-18
Online:2025-09-23
Published:2025-09-30
Contact:
ZHU Haijing, HUA Jinlian
E-mail:wcl1996@nwafu.edu.cn;shicheng_wan@nwafu.edu.cn;haijingzhu@yulinu.edu.cn;jinlianhua@nwsuaf.edu.cn
CLC Number:
WANG Congliang, WAN Shicheng, CHEN Wenbo, LI Jiannan, SONG Yanfeng, DU Xiaomin, LIU Wangye, LI Rongrong, LEI Anmin, QU Lei, ZHU Haijing, HUA Jinlian. Production and Biosafety Assessment of BLOC1S1 Gene Overexpression Goats[J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(9): 4328-4340.
Table 1
The primers used in this experiment"
| 引物名称 Primer name | 引物序列(5′→3′) Primer sequence | 退火温度/℃ Tm | 产物长度/bp Products length |
| BLOC1S1-F | ttctagagctagcGAATTCGATGCTGTCCCGCTTGCTGAA | 65 | 418 |
| BLOC1S1-R | ccttcgcggccgcGGATCCGCTAGGAGGGGGCCGACTGCA | ||
| CMV/BLOC1S1-F | AGTGAACCGTCAGATCGCCT | 58 | 442 |
| CMV/BLOC1S1-R | ACTGCAGCTGCCCTTTGTAG | ||
| Q-BLOC1S1-F | AGGAAGCTTGACCATGAGGTG | 60 | 110 |
| Q-BLOC1S1-R | TCCTTGAGTGCCTGGTTGAAG | ||
| Q-β-ACTIN-F | TGATATTGCTGCGCTCGT | 60 | 196 |
| Q-β-ACTIN-R | CTTGAGGGTCAGGATGCC |
Fig. 1
Identification of BLOC1S1 gene overexpression goats A. PCR identification of BLOC1S1 gene overexpression lambs (M. Marker; 1. Negative control; 2. Blank control; 3. Positive control; 7, 9-12, 15, 16. Positive goats; 4, 5, 6, 8, 13, 14. Negative goats); B. qRT-PCR detection of BLOC1S1 gene mRNA expression in tissues of gene overexpression and wild-type goats; C. Western blotting to detect BLOC1S1 protein expression in spleen tissues of gene overexpression and wild-type goats; D. The quantification of Western blotting results. *. P < 0.05, **. P < 0.01, ***. P < 0.001"
Fig. 2
The physiological and biochemical indexes of blood in BLOC1S1 gene overexpressed rams A. Blood physiological indices of BLOC1S1 gene overexpression rams; B. Blood biochemical indices of BLOC1S1 gene overexpression rams. WBC. White blood cell; Neu. Neutrophils; Lym. Lymphocytes; Mon. Monocytes; Eos. Eosinophils; HGB. Hemoglobin; MPV. Mean platelet volume; PDW. Platelet distribution width; TBIL. Total bilirubin; LDH. Lactate dehydrogenase; ALT. Alanine aminotrans ferase; ALB. Albumin; GLU. Glucose; AST. Aspartate aminotransferase; CK. Creatine kinase; CREA. Creatinine; the same as below"
| 1 |
DAUGALIYEVA A , DAUGALIYEVA S , ABUTALIP A , et al. Study of epidemiological and molecular characteristics of Brucella strains circulating in Kazakhstan[J]. Vet Res Commun, 2025, 49 (3): 156.
doi: 10.1007/s11259-025-10725-9 |
| 2 |
CAO X , LIU P , WU J , et al. Genome phylogenetic analysis of Brucella melitensis in Northwest China[J]. BMC Microbiol, 2025, 25 (1): 208.
doi: 10.1186/s12866-025-03943-3 |
| 3 |
FERJANI A , BUIJZE H , KOPPRIO G , et al. A genomic characterization of clinical brucella melitensis isolates from tunisia: integration into the global population structure[J]. Microorganisms, 2025, 13 (2): 243.
doi: 10.3390/microorganisms13020243 |
| 4 |
KALDS P , ZHOU S , CAI B , et al. Sheep and goat genome engineering: from random transgenesis to the CRISPR era[J]. Front Genet, 2019, 10, 750.
doi: 10.3389/fgene.2019.00750 |
| 5 |
LOIS C , HONG E J , PEASE S , et al. Germline transmission and tissue-specific expression of transgenes delivered by lentiviral vectors[J]. Science, 2002, 295 (5556): 868- 872.
doi: 10.1126/science.1067081 |
| 6 |
HOFMANN A , KESSLER B , EWERLING S , et al. Efficient transgenesis in farm animals by lentiviral vectors[J]. EMBO Rep, 2003, 4 (11): 1054- 1060.
doi: 10.1038/sj.embor.7400007 |
| 7 |
HOFMANN A , ZAKHARTCHENKO V , WEPPERT M , et al. Generation of transgenic cattle by lentiviral gene transfer into oocytes[J]. Biol Reprod, 2004, 71 (2): 405- 409.
doi: 10.1095/biolreprod.104.028472 |
| 8 |
YANG S H , CHENG P H , BANTA H , et al. Towards a transgenic model of huntington's disease in a non-human primate[J]. Nature, 2008, 453 (7197): 921- 924.
doi: 10.1038/nature06975 |
| 9 |
GÓMEZ M C , POPE C E , KUTNER R H , et al. Generation of domestic transgenic cloned kittens using lentivirus vectors[J]. Cloning Stem Cells, 2009, 11 (1): 167- 176.
doi: 10.1089/clo.2008.0054 |
| 10 |
CRISPO M , VILARIÑO M , DOS SANTOS N P C , et al. Embryo development, fetal growth and postnatal phenotype of eGFP lambs generated by lentiviral transgenesis[J]. Transgenic Res, 2015, 24 (1): 31- 41.
doi: 10.1007/s11248-014-9816-x |
| 11 |
DENG S , WU Q , YU K , et al. Changes in the relative inflammatory responses in sheep cells overexpressing of toll-like receptor 4 when stimulated with LPS[J]. PLoS One, 2012, 7 (10): e47118.
doi: 10.1371/journal.pone.0047118 |
| 12 |
WANG S , SONG X , ZHANG K , et al. Overexpression of toll-like receptor 4 affects autophagy, oxidative stress, and inflammatory responses in monocytes of transgenic sheep[J]. Front Cell Dev Biol, 2020, 8, 248.
doi: 10.3389/fcell.2020.00248 |
| 13 |
LI G , LV D , YAO Y , et al. Overexpression of ASMT likely enhances the resistance of transgenic sheep to brucellosis by influencing immune-related signaling pathways and gut microbiota[J]. FASEB J, 2021, 35 (9): e21783.
doi: 10.1096/fj.202100651R |
| 14 |
BROWN J L , VOTH J P , PERSON K , et al. A technological and regulatory review on human-animal chimera research: the current landscape of biology, law, and public opinion[J]. Cell Transplant, 2023, 32, 9636897231183112.
doi: 10.1177/09636897231183112 |
| 15 |
PU J , SCHINDLER C , JIA R , et al. BORC, a multisubunit complex that regulates lysosome positioning[J]. Dev Cell, 2015, 33 (2): 176- 188.
doi: 10.1016/j.devcel.2015.02.011 |
| 16 |
GUARDIA C M , FARÍAS G G , JIA R , et al. BORC functions upstream of kinesins 1 and 3 to coordinate regional movement of lysosomes along different microtubule tracks[J]. Cell Rep, 2016, 17 (8): 1950- 1961.
doi: 10.1016/j.celrep.2016.10.062 |
| 17 |
PU J , KEREN K T , BONIFACINO J S . A ragulator-BORC interaction controls lysosome positioning in response to amino acid availability[J]. J Cell Biol, 2017, 216 (12): 4183- 4197.
doi: 10.1083/jcb.201703094 |
| 18 |
STARCEVIC M , DELL A E C . Identification of snapin and three novel proteins (BLOS1, BLOS2, and BLOS3/reduced pigmentation) as subunits of biogenesis of lysosome-related organelles complex-1 (BLOC-1)[J]. J Biol Chem, 2004, 279 (27): 28393- 28401.
doi: 10.1074/jbc.M402513200 |
| 19 | 万仕成, 张梦菲, 陈文博, 等. BLOC1S1促进山羊精原干细胞增殖[J]. 生物工程学报, 2023, 39 (12): 4901- 4914. |
| WAN S C , ZHANG M F , CHEN W B , et al. BLOC1S1 promotes proliferation of goat spermatogonial stem cells[J]. Chinese Journal of Biotechnology, 2023, 39 (12): 4901- 4914. | |
| 20 |
MILLER C N , SMITH E P , CUNDIFF J A , et al. A brucella type Ⅳ effector targets the COG tethering complex to remodel host secretory traffic and promote intracellular replication[J]. Cell Host Microbe, 2017, 22 (3): 317- 329.
doi: 10.1016/j.chom.2017.07.017 |
| 21 |
JIA R , GUARDIA C M , PU J , et al. BORC coordinates encounter and fusion of lysosomes with autophagosomes[J]. Autophagy, 2017, 13 (10): 1648- 1663.
doi: 10.1080/15548627.2017.1343768 |
| 22 |
BRIGHT M D , ITZHAK D N , WARDELL C P , et al. Cleavage of BLOC1S1 mRNA by IRE1 is sequence specific, temporally separate from XBP1 splicing, and dispensable for cell viability under acute endoplasmic reticulum stress[J]. Mol Cell Biol, 2015, 35 (12): 2186- 2202.
doi: 10.1128/MCB.00013-15 |
| 23 |
PANDEY A , LIN F , CABELLO A L , et al. Activation of Host IRE1α-dependent signaling axis contributes the intracellular parasitism of brucella melitensis[J]. Front Cell Infect Microbiol, 2018, 8, 103.
doi: 10.3389/fcimb.2018.00103 |
| 24 |
LIU Y , BAI X , FENG X , et al. Revolutionizing animal husbandry: breakthroughs in gene editing delivery systems[J]. Gene, 2025, 935, 149044.
doi: 10.1016/j.gene.2024.149044 |
| 25 |
SHAKWEER W M E , KRIVORUCHKO A Y , DESSOUKI S M , et al. A review of transgenic animal techniques and their applications[J]. J Genet Eng Biotechnol, 2023, 21 (1): 55.
doi: 10.1186/s43141-023-00502-z |
| 26 |
LEAL A F , HERRENO-PACHÓN A M , BENINCORE-FLÓREZ E , et al. Current strategies for increasing knock-in efficiency in CRISPR/Cas9-based approaches[J]. Int J Mol Sci, 2024, 25 (5): 2456.
doi: 10.3390/ijms25052456 |
| 27 |
XU Y N , UHM S J , KOO B C , et al. Production of transgenic Korean native cattle expressing enhanced green fluorescent protein using a FIV-based lentiviral vector injected into MII oocytes[J]. J Genet Genomics, 2013, 40 (1): 37- 43.
doi: 10.1016/j.jgg.2012.11.001 |
| 28 |
HUNTER C V , TILEY L S , SANG H M . Developments in transgenic technology: applications for medicine[J]. Trends Mol Med, 2005, 11 (6): 293- 298.
doi: 10.1016/j.molmed.2005.04.001 |
| 29 |
WHITELAW C B . Transgenic livestock made easy[J]. Trends Biotechnol, 2004, 22 (4): 157- 169.
doi: 10.1016/j.tibtech.2004.02.005 |
| 30 |
SALGADO B , RIVAS R B , PINTO D , et al. Genetically modified pigs lacking CD163 PSTⅡ-domain-coding exon 13 are completely resistant to PRRSV infection[J]. Antiviral Res, 2024, 221, 105793.
doi: 10.1016/j.antiviral.2024.105793 |
| 31 |
YUAN M , ZHANG J , GAO Y , et al. HMEJ-based safe-harbor genome editing enables efficient generation of cattle with increased resistance to tuberculosis[J]. J Biol Chem, 2021, 296, 100497.
doi: 10.1016/j.jbc.2021.100497 |
| 32 | FENG R , ZHAO J , ZHANG Q , et al. Generation of anti-mastitis gene-edited dairy goats with enhancing lysozyme expression by inflammatory regulatory sequence using ISDra2-TnpB system[J]. Adv Sci, 2024, 5, 2404408. |
| 33 |
DENG S , LI G , ZHANG J , et al. Transgenic cloned sheep overexpressing ovine toll-like receptor 4[J]. Theriogenology, 2013, 80 (1): 50- 57.
doi: 10.1016/j.theriogenology.2013.03.008 |
| 34 |
NKHABINDZE B Z , MAGAGULA C N , EARNSHAW D , et al. Regulatory framework for genetically modified organisms in the Kingdom of Eswatini[J]. GM Crops Food, 2024, 15 (1): 212- 221.
doi: 10.1080/21645698.2024.2375664 |
| 35 |
SHARMA M K , LEE J , SHI H , et al. Effect of dietary inclusion of 25-hydroxyvitamin D3 and vitamin E on performance, gut health, oxidative status, and immune response in laying hens infected with coccidiosis[J]. Poult Sci, 2024, 103 (9): 104033.
doi: 10.1016/j.psj.2024.104033 |
| 36 |
KOOPMANS L , SPOELDER M , BONGERS C , et al. The effect of lesser mealworm protein on exercise-induced muscle damage in active older adults: a randomized controlled trial[J]. J Nutr Health Aging, 2024, 28 (5): 100204.
doi: 10.1016/j.jnha.2024.100204 |
| 37 |
LIU Z , JIN P , LIU Y , et al. A comprehensive approach to lifestyle intervention based on a calorie-restricted diet ameliorates liver fat in overweight/obese patients with NAFLD: a multicenter randomized controlled trial in China[J]. Nutr J, 2024, 23 (1): 64.
doi: 10.1186/s12937-024-00968-8 |
| 38 |
LV X , LIU Y , LIU S , et al. Metabonomics and pharmacodynamics studies of gentiana radix and wine-processed gentiana radix in damp-heat jaundice syndrome rats[J]. J Ethnopharmacol, 2024, 332, 118291.
doi: 10.1016/j.jep.2024.118291 |
| 39 |
ZHU C , LIU Y , XU H , et al. Production of second-generation sheep clones via somatic cell nuclear transfer using amniotic cells as nuclear donors[J]. Theriogenology, 2025, 232, 79- 86.
doi: 10.1016/j.theriogenology.2024.11.001 |
| 40 |
YAO Y C , HAN H B , SONG X T , et al. Growth performance, reproductive traits and offspring survivability of genetically modified rams overexpressing toll-like receptor 4[J]. Theriogenology, 2017, 96, 103- 110.
doi: 10.1016/j.theriogenology.2017.04.006 |
| 41 | 柴孟龙. 抗病转基因羊胚胎生产、移植及后代生物安全评价研究[D]. 长春: 吉林农业大学, 2012. |
| CHAI M L. Disease resistance transferred gene sheep embryo production, transplantation and future generations biosafety evaluation research[D]. Changchun: Jilin Agricultural University, 2012. (in Chinese) | |
| 42 |
JACKSON K A , BERG J M , MURRAY J D , et al. Evaluating the fitness of human lysozyme transgenic dairy goats: growth and reproductive traits[J]. Transgenic Res, 2010, 19 (6): 977- 986.
doi: 10.1007/s11248-010-9371-z |
| 43 | SMITH E P , COTTO R A , BORGHESAN E , et al. Epistatic interplay between type Ⅳ secretion effectors engages the small GTPase Rab2 in the Brucella intracellular cycle[J]. mBio, 2020, 11 (2): 3350. |
| 44 |
STARR T , CHILD R , WEHRLY T D , et al. Selective subversion of autophagy complexes facilitates completion of the brucella intracellular cycle[J]. Cell Host Microbe, 2012, 11 (1): 33- 45.
doi: 10.1016/j.chom.2011.12.002 |
| 45 |
CELLI J , TSOLIS R M . Bacteria, the endoplasmic reticulum and the unfolded protein response: friends or foes?[J]. Nat Rev Microbiol, 2015, 13 (2): 71- 82.
doi: 10.1038/nrmicro3393 |
| 46 |
WU K , SEYLANI A , WU J , et al. BLOC1S1/GCN5L1/BORCS1 is a critical mediator for the initiation of autolysosomal tubulation[J]. Autophagy, 2021, 17 (11): 3707- 3724.
doi: 10.1080/15548627.2021.1894759 |
| 47 |
WELLS K M , HE K , PANDEY A , CABELLO A , et al. Brucella activates the host RIDD pathway to subvert BLOS1-directed immune defense[J]. Elife, 2022, 11, e73625.
doi: 10.7554/eLife.73625 |
| [1] | MA Yannan, LI Zhengjie, ZHANG Xiao, GUO Beibei, FANG Hua, LIU Zijia, CHEN Shiwei, HE Pengjia, WANG Xiaolong, CHEN Yulin, LEI Zhaomin. Methodological Theory of Linear Appraisal for Conformation Traits of Dairy Goats in China [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(9): 4341-4354. |
| [2] | LIU Can, SU Yixin, JING Xianjin, LI Wenze, YANG Lepu, WANG Ruijun, ZHANG Yanjun, WANG Zhiying, LÜ Qi, SU Rui. Research Progress of Epigenetics in Sheep and Goats Genetic Breeding [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(8): 3561-3577. |
| [3] | REN Qianzi, ZHANG Baizhong, WANG Zhenqing, WANG Xianglin, GONG Ying, HU Renke, PU Yabin, SU Peng, LI Yefang, MA Yuehui, LI Haobang, JIANG Lin. Genetic Evolutionary Analysis of Wuxue Goat Based on Whole Genome Resequencing [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(8): 3787-3801. |
| [4] | FENG Jintao, YAN Yan, ZONG Junlin, HU Yuqing, LI Xiaorui, GUAN Weijun, LI Yaokun. Isolation and Culture of Goat Umbilical Cord Mesenchymal Stem Cells for the Treatment of Drug-induced Liver Injury in Mice [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(8): 4053-4064. |
| [5] | LIU Yuxin, CHEN Si, GAO Yang, GU Deyuan, PENG Haitao, ZHANG Dong, ZHANG Ru, XU Huihui, LIU Yaqiao, YANG Yanling. Proteomic Analysis and Immunogenicity Evaluation of Outer Membrane Vesicles of Brucella melitensis [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(7): 3378-3389. |
| [6] | LIU Aijun, HUANG Xiaobing, ZHANG Chuanliang, ZHANG Hongli. Progress on the Interactions of Brucella with Host Innate Immunity Signaling Pathways [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(4): 1561-1574. |
| [7] | YOU Liuchao, YIN Hao, TAO Zhengyu, HUANG Rong, FU Lei, CHU Yuefeng. Research Progress in the Virulence Factors and Intracellular Survival Mechanism of Brucella [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(4): 1575-1593. |
| [8] | WANG Haoyu, MA Keyan, LI Taotao, LI Dengpan, ZHAO Qing, MA Youji. Population Genetic Diversity and Population Structure Analysis of Small-boned Goat Based on Specific-Locus Amplified Fragment Sequencing [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(3): 1170-1179. |
| [9] | ABABAIKERI Buweihailiqiemu, AIHEMAITIJIANG Aihemaitiniyazi, MOHAMMADTURSUN Nabijan, SHAN Wenjuan. Preliminary Study on the Function of PRDX1 Antioxidant Gene in Tarim Red Deer [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(3): 1216-1230. |
| [10] | YANG Xiaowen, NING Wenqing, ZHOU Shizhong, YUAN Yaqin, HOU Xuexin, DING Jiabo. Establishment of a Quantitative Real-time PCR Detection Method for Trimethoprim-Sulfamethoxazole-resistance Strains of Brucella melitensis [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(3): 1465-1472. |
| [11] | XI Haijiao, LI Jinquan, ZHANG Yanjun, WANG Ruijun, LÜ Qi, MEI Bujun, WANG Na, SU Rui, WANG Zhiying. Influence of Dominance Effects on the Accuracy of Breeding Value Estimation of Cashmere Production and Cashmere Diameter in Inner Mongolia Cashmere Goats [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(2): 571-581. |
| [12] | FENG Jing, SHENG Hui, ZHANG Xiaosheng, GUO Xiaofei, YAO Dawei, LI Yupeng, CHEN Longbin, ZHANG Jinlong. miR-665 Targeting BCL2L11 Regulates the Myoblasts Proliferation of Wu'an Goat [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(2): 582-590. |
| [13] | LI Zhihui, LUO Jinlin, XIE Hong, LI Mingkun, LIN Yang, ZHANG Yujiao, XU Yindi, CHEN Huanchun, CAI Xuwang, XU Xiaojuan. Construction of the Gleasserella parasuis Strain Overexpressing OppA and Evaluation of Its Immunogenicity and Efficacity in Mice [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(2): 860-869. |
| [14] | WANG Xiaofei, WANG Bosen, WEI Mengyao, JIANG Luyao, XU Ganggang, LIU Jiaxin, MA Yingtian, WANG Li, SONG Yuxuan, ZHANG Lei. Study on the Role of Ewe's Milk in Ameliorating Pathological Changes in the Liver and Kidney of Mice in a Diabetes Model [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(2): 870-882. |
| [15] | YU Fengjiao, LIU Kaidong, SONG Weijie, LIU Nan, LI Hegang, ZHAO Jinshan, GAO Xiaoxiao, HE Jianning. Mechanism of miR-137 Targeting MITF Regulating Melanogenesis in Goat Melanocytes [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(1): 189-200. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||