转录组测序筛选牛卵泡发育偏差和优势卵泡选择相关基因

doi:10.11843/j.issn.0366-6964.2024.11.023

Abstract

Abstract:

The study aimed to screen genes related to the deviation of follicular development and dominant follicle selection in cattle. In this study, 6 healthy 10-month-old Hayford young cows were divided into two groups on average after synchronization. The first group collected the first and second largest follicles before the deviation of the first follicle development wave. The second group collected the first and second largest follicles after the deviation of the first follicle development wave. RNA of follicular granulosa cells was extracted for transcriptome sequencing, and the sequencing results were compared with the reference genome. The PDF1-VS-PDF2 group was screened for differentially expressed genes affecting follicular development. ODF1-VS-ODF2 group, ODF1-VS-PDF1 group and ODF1-VS-PDF2 group screened DEGs that affected dominant follicle selection, and performed GO and KEGG enrichment analysis and PPI analysis to screen key genes. The accuracy of the screened genes was verified by RT-qPCR and Western blotting. The results showed that 220 DEGs were found in the PDF1-VS-PDF2 group, 179 of which were up-regulated and 41 were down-regulated. GO and KEGG analysis showed that PI3K-Akt signaling pathway and TGF-β signaling pathway were related to follicular development. PPI analysis showed that MYC, BRCA1, EZH2, ARID1A and SMARCA4 were hub genes. A total of 184 DEGs were found in ODF1-VS-ODF2 group, 93 were up-regulated and 91 were down-regulated. GO and KEGG analysis showed that TGF-β signaling pathway, PI3K-Akt signaling pathway, Jak-STAT signaling pathway, TNF signaling pathway, mTOR signaling pathway and cell adhesion molecules were related to follicular development. PPI analysis showed that POLR2A, FOS, HIF1A, KIT and SOCS3 were hub genes. A total of 837 DEGs were found in ODF1-VS-PDF1 group and ODF1-VS-PDF2 group, of which 360 were up-regulated and 477 were down-regulated. GO and KEGG analysis showed that mTOR signaling pathway, TNF signaling pathway, TGF-β signaling pathway, PI3K-Akt signaling pathway, progestin (P₄)-mediated oocyte maturation pathway were related to follicular development. PPI analysis showed that HIF1A, RPS9, COL1A2, PIK3R1, COL4A1, ITSN1, GNB1, RPL3, ESPL1, CUL7 were the hub genes. RT-qPCR results showed that the expression of BRCA1, ARID1A and EZH2 in PDF1 was higher than that in PDF2, and the expression of POLR2A in ODF1 was higher than that in ODF2. Western blotting results showed that the expression of BRCA1 and EZH2 in PDF1 was higher than that in PDF2. In this study, MYC, BRCA1, EZH2, ARID1A and SMARCA4 may play a role in the deviation of bovine follicle development. POLR2A, FOS, HIF1A, KIT, SOCS3, RPS9, COL1A2, PIK3R1, COL4A1, ITSN1, GNB1, RPL3, ESPL1 and CUL7 may play a role in the selection process of bovine DF. The results of this study laid a foundation for exploring the theory of regulation of bovine follicle development deviation and dominant follicle selection gene.

Key words: bovine, transcriptome, follicular development, genes

CLC Number:

S823.2

Hongtai ZHOU, Junrong YAN, Pengfei LI. Transcriptome Sequencing was Used to Screen Genes Related to Follicular Development Bias and Dominant Follicle Selection in Cattle[J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(11): 5059-5071.

Figures/Tables 12

Table 1

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Fig. 6

Fig. 7

Fig. 8

Fig. 9

Fig. 10

Fig. 11

References 40

1	GASPERIN B G , FERREIRA R , ROVANI M T , et al. Expression of receptors for BMP15 is differentially regulated in dominant and subordinate follicles during follicle deviation in cattle[J]. Anim Reprod Sci, 2014, 144 (3-4): 72- 78. doi: 10.1016/j.anireprosci.2013.12.002
2	ORTEGA SERRANO P V , GUZMÁN A , HERNÁNDEZ-CORONADO C G , et al. Reduction in the mRNA expression of sVEGFR1 and sVEGFR2 is associated with the selection of dominant follicle in cows[J]. Reprod Domest Anim, 2016, 51 (6): 985- 991. doi: 10.1111/rda.12777
3	ERVIN J M , SCHÜTZ L F , SPICER L J . Current status of the role of endothelins in regulating ovarian follicular function: a review[J]. Anim Reprod Sci, 2017, 186, 1- 10. doi: 10.1016/j.anireprosci.2017.09.008
4	HU W Q , ZENG H T , SHI Y N , et al. Single-cell transcriptome and translatome dual-omics reveals potential mechanisms of human oocyte maturation[J]. Nat Commun, 2022, 13 (1): 5114. doi: 10.1038/s41467-022-32791-2
5	LIAO B Y , QI X Y , YUN C Y , et al. Effects of androgen excess-related metabolic disturbances on granulosa cell function and follicular development[J]. Front Endocrinol (Lausanne), 2022, 13, 815968. doi: 10.3389/fendo.2022.815968
6	YAN X Y , HOU L L , ZHANG C . FOXG1 is involved in mouse ovarian functions and embryogenesis[J]. J Steroid Biochem Mol Biol, 2023, 233, 106372. doi: 10.1016/j.jsbmb.2023.106372
7	CADENAS J , POULSEN L C , NIKIFOROV D , et al. Regulation of human oocyte maturation in vivo during the final maturation of follicles[J]. Hum Reprod, 2023, 38 (4): 686- 700. doi: 10.1093/humrep/dead024
8	HE Q K , LI Y P , XU Z R , et al. 3-MCPD exposure enhances ovarian fibrosis and reduces oocyte quality in mice[J]. Environ Pollut, 2023, 316 (Pt 2): 120662.
9	GINTHER O J . The theory of follicle selection in cattle[J]. Domest Anim Endocrinol, 2016, 57, 85- 99. doi: 10.1016/j.domaniend.2016.06.002
10	JIA Y H , LIU Y F , WANG P , et al. NTRK2 promotes sheep granulosa cells proliferation and reproductive hormone secretion and activates the PI3K/AKT pathway[J]. Animals (Basel), 2024, 14 (10): 1465.
11	ZHOU Y , ZHANG S H , JIA Y R , et al. Regulation and role of adiponectin secretion in rat ovarian granulosa cells[J]. Int J Mol Sci, 2024, 25 (10): 5155. doi: 10.3390/ijms25105155
12	GUPTA P S P , FOLGER J K , RAJPUT S K , et al. Regulation and regulatory role of WNT signaling in potentiating FSH action during bovine dominant follicle selection[J]. PLoS One, 2014, 9 (6): e100201. doi: 10.1371/journal.pone.0100201
13	GUZMÁN A , HUGHES C H K , MURPHY B D . Orphan nuclear receptors in angiogenesis and follicular development[J]. Reproduction, 2021, 162 (3): R35- R54. doi: 10.1530/REP-21-0118
14	FU Y , ZHANG M J , SUI B D , et al. Mesenchymal stem cell-derived apoptotic vesicles ameliorate impaired ovarian folliculogenesis in polycystic ovary syndrome and ovarian aging by targeting WNT signaling[J]. Theranostics, 2024, 14 (8): 3385- 3403. doi: 10.7150/thno.94943
15	LI Y T , JING J J , DANG W Q , et al. Cross-talk between NOTCH2 and BMP4/SMAD signaling pathways in bovine follicular granulosa cells[J]. Theriogenology, 2022, 187, 74- 81. doi: 10.1016/j.theriogenology.2022.04.016
16	LIU J , GUO C H , FU J J , et al. Identification and functional analysis of circRNAs during goat follicular development[J]. Int J Mol Sci, 2024, 25 (14): 7548. doi: 10.3390/ijms25147548
17	LIU W J , DU C , NAN L K , et al. Influence of estrus on dairy cow milk exosomal miRNAs and their role in hormone secretion by granulosa cells[J]. Int J Mol Sci, 2023, 24 (11): 9608. doi: 10.3390/ijms24119608
18	CAI J W , LI Y P , ZHAO B H , et al. N-acetylcysteine alleviates d-galactose-induced injury of ovarian granulosa cells in female rabbits by regulating the PI3K/Akt/mTOR signaling pathway[J]. Antioxidants (Basel), 2024, 13 (4): 384. doi: 10.3390/antiox13040384
19	SUN T T , XIAO C , YANG Z L , et al. Grade follicles transcriptional profiling analysis in different laying stages in chicken[J]. BMC Genomics, 2022, 23 (1): 492. doi: 10.1186/s12864-022-08728-w
20	SHEN Z L , CHEN Z Y , JI Y , et al. TREM2 as a prognostic biomarker for osteosarcoma microenvironment remodeling[J]. J Oncol, 2023, 2023, 3677789.
21	CANTANHÊDE L F , MOURA M T , OLIVEIRA-SILVA R L , et al. MYC integrates FSH signalling networks in cumulus cells during bovine oocyte maturation[J]. Acta Vet Hung, 2022, doi: 10.1556/004.2022.00007
22	PIONTKEWITZ Y , SUNDFELDT K , HEDIN L . The expression of c-myc during follicular growth and luteal formation in the rat ovary in vivo[J]. J Endocrinol, 1997, 152 (3): 395- 406. doi: 10.1677/joe.0.1520395
23	HATZIRODOS N , HUMMITZSCH K , IRVING-RODGERS H F , et al. Transcriptome profiling of granulosa cells from bovine ovarian follicles during atresia[J]. BMC Genomics, 2014, 15, 40. doi: 10.1186/1471-2164-15-40
24	LI L Y , SHI X J , SHI Y , et al. The signaling pathways involved in ovarian follicle development[J]. Front Physiol, 2021, 12, 730196. doi: 10.3389/fphys.2021.730196
25	PHILLIPS K W , GOLDSWORTHY S M , BENNETT L M , et al. Brca1 is expressed independently of hormonal stimulation in the mouse ovary[J]. Lab Invest, 1997, 76 (3): 419- 425.
26	YEN H Y , GABET Y , LIU Y , et al. Alterations in Brca1 expression in mouse ovarian granulosa cells have short-term and long-term consequences on estrogen-responsive organs[J]. Lab Invest, 2012, 92 (6): 802- 811. doi: 10.1038/labinvest.2012.58
27	HUO S W , QI H R , SI Y X , et al. MicroRNA 26a targets Ezh2 to regulate apoptosis in mouse ovarian granulosa cells[J]. Syst Biol Reprod Med, 2021, 67 (3): 221- 229. doi: 10.1080/19396368.2021.1895362
28	JI X L , LIU X , WANG Z , et al. Expression of ARID1A in polycystic ovary syndrome and its effect on the proliferation and apoptosis of ovarian granulosa cells[J]. Ann Endocrinol (Paris), 2020, 81 (6): 521- 529. doi: 10.1016/j.ando.2020.11.008
29	HUNZICKER-DUNN M E , LOPEZ-BILADEAU B , LAW N C , et al. PKA and GAB2 play central roles in the FSH signaling pathway to PI3K and AKT in ovarian granulosa cells[J]. Proc Natl Acad Sci U S A, 2012, 109 (44): E2979- E2988.
30	LISBOA L A , BORDIGNON V , SENEDA M M . Immunolocalization of BRG1-SWI/SNF protein during folliculogenesis in the porcine ovary[J]. Zygote, 2012, 20 (3): 243- 248. doi: 10.1017/S0967199411000098
31	GONG J G , CAMPBELL B K , WEBB R . Defining the gonadotrophin requirement for the selection of a single dominant follicle in cattle[J]. Reprod Fertil Dev, 2020, 32 (3): 322- 334. doi: 10.1071/RD19060
32	WEBB R , GARNSWORTHY P C , GONG J G , et al. Control of follicular growth: local interactions and nutritional influences[J]. J Anim Sci, 2004, 82 E-Suppl, E63- E74.
33	DIAS F C F , KHAN M I R , SIRARD M A , et al. Differential gene expression of granulosa cells after ovarian superstimulation in beef cattle[J]. Reproduction, 2013, 146 (2): 181- 191. doi: 10.1530/REP-13-0114
34	CHOI Y , ROSEWELL K L , BRÄNNSTRÖM M , et al. FOS, a critical downstream mediator of PGR and EGF signaling necessary for ovulatory prostaglandins in the human ovary[J]. J Clin Endocrinol Metab, 2018, 103 (11): 4241- 4252. doi: 10.1210/jc.2017-02532
35	BERISHA B , SCHAMS D , SINOWATZ F , et al. Hypoxia-inducible factor-1alpha and nitric oxide synthases in bovine follicles close to ovulation and early luteal angiogenesis[J]. Reprod Domest Anim, 2020, 55 (11): 1573- 1584. doi: 10.1111/rda.13812
36	LUSSIER J G , DIOUF M N , LÉVESQUE V , et al. Gene expression profiling of upregulated mRNAs in granulosa cells of bovine ovulatory follicles following stimulation with hCG[J]. Reprod Biol Endocrinol, 2017, 15 (1): 88. doi: 10.1186/s12958-017-0306-x
37	ZAREIFARD A , BEAUDRY F , NDIAYE K . Janus Kinase 3 phosphorylation and the JAK/STAT pathway are positively modulated by follicle-stimulating hormone (FSH) in bovine granulosa cells[J]. BMC Mol Cell Biol, 2023, 24 (1): 21. doi: 10.1186/s12860-023-00482-5
38	HAO E Y , LIU X L , CHANG L Y , et al. Melatonin alleviates endoplasmic reticulum stress to improve ovarian function by regulating the mTOR pathway in aged laying hens[J]. Poult Sci, 2024, 103 (6): 103703. doi: 10.1016/j.psj.2024.103703
39	HU C F , ZHAO X Y , CUI C , et al. miRNA-29-3p targets PTEN to regulate follicular development through the PI3K/Akt/mTOR signaling pathway[J]. Theriogenology, 2024, 214, 173- 181. doi: 10.1016/j.theriogenology.2023.10.024
40	CAMPBELL I D , HUMPHRIES M J . Integrin structure, activation, and interactions[J]. Cold Spring Harb Perspect Biol, 2011, 3 (3): a004994.

基因 Gene	上游引物(5'→3') Forward primer	下游引物(5'→3') Reverse primer
BRCA1	F：GCGTCCTTCCAAACAAGTGTATCAG	R：CCAAGCCAGTTTCCCTTTCTTCATC
ARID1A	F：ACAGCCGAATCTCATGCCTTCC	R：AGCGGAGAACTGATTGCCATAGG
POLR2A	F：TCAACTGTATCCGCACCCATAGC	R：GCCATTCTCCACCACCACCTTAG
EZH2	F：AGGAGGAGAAGAAGGACGAGACC	R：GTGCCGATGAGGACCCTGAAC
β-actin	F：GCGTTACACCCTTTTTCTTGACA	R：TCACCTTCACCGTTCCAGTT

[1]	Fangzhou WANG, Lingyun TAN, Yan LI, Hongjing GU, Hui WANG. Progress on the Characteristics of Virus-encoded Proteins and Pathogenic Mechanism of Henipavirus [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(9): 3802-3811.
[2]	Yi WANG, Jianfei GONG, Nuo HENG, Yingfan HU, Rui WANG, Huan WANG, Ni ZHU, Wei HE, Zhihui HU, Haisheng HAO, Huabin ZHU, Shanjiang ZHAO. Melatonin Alleviates Palmitic Acid-induced Damage in Bovine Endometrial Epithelial Cells by Improving Mitochondrial Dynamics [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(9): 3978-3987.
[3]	Jinrui MA, Wenjing SHI, Changqing TIAN, Zhijie DONG, Xuehui ZHAO, Ji ZHI, Qing CAO, Yanquan WEI, Weili SONG, Huiwen XUE, Huitian GOU. Preparation of Monoclonal Antibodies against Internalin G of Listeria monocytogenes and Their Preliminary Application [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(9): 4069-4076.
[4]	Xiaoxu ZHANG, Hao LI, Pingjie FENG, Hao YANG, Xinyue LI, Ran LÜ, Zhangyuan PAN, Mingxing CHU. Application of Single-Cell Transcriptome Sequencing Technology in Domesticated Animals [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(8): 3276-3287.
[5]	Shuying DAI, Qing LIU, Aiguo LI, Bo YU, Hongbo CHEN. Research Progress on Culture Medium Additives in Bovine In Vitro Embryo Production [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(8): 3309-3320.
[6]	Jing CHEN, Xuebei WU, Dongzhi MIAO, Chi ZHANG, Zhenyu GUO, Ying WANG. Comparative Analysis of Transcriptome of Pigeon Follicles at Early Stage of Laying Interval Reveals Genes Related to Follicular Development [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(8): 3503-3515.
[7]	Ya’nan LI, Tianwen MA, Yuhui MA, Chengwei WEI. Bilobalide Regulates Mitochondrial Biogenesis Mediated by AMPK-SIRT3 Positive Feedback Loop and Improves Inflammatory Damage of ATDC5 Chondrocytes [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(8): 3714-3724.
[8]	Wanqing LI, Yaqi ZENG, Xinkui YAO, Jianwen WANG, Xinxin YUAN, Chen MENG, Yuanfang SUN, Xuan PENG, Jun MENG. Comparative Analysis of Blood Transcriptome in Yili Horses Bred for Meat Performance [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(7): 2951-2962.
[9]	Wangqing BAN MA, Xi CHEN, Yi YUE, Yurong SU, Hua YUE, Cheng TANG. Isolation, Identification and Partial Biological Characteristics of a Bovine Respiratory Coronavirus [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(7): 3094-3104.
[10]	Mingliang HE, Xiaoyang LÜ, Yongqing JIANG, Zhenghai SONG, Yeqing WANG, Huiguo YANG, Shanhe WANG, Wei SUN. Function Analysis of SOX18 in Hu Sheep Hair Follicle Dermal Papilla Cells Based on Transcriptome Sequencing [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2409-2420.
[11]	Xiaoyi FENG, Peipei ZHANG, Hang ZHANG, Haisheng HAO, Weihua DU, Huabin ZHU, Kai CUI, Xueming ZHAO. Effects of Heat Stress on Epigenetic Modifications and Developmental Competence of Bovine Oocytes and Their Embryos [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2460-2473.
[12]	Huijie REN, Xun MA, Jing WANG, Caixia LIU, Dongdong ZENG, Lijun KOU, Weidi SHI, Shuangfei LÜ, Ruixuan QIAN, Shengjie GAO. Construction and Partial Biological Characteristics Trial of Lm4b_02325/26 Double Gene Deletion Strain of Listeria monocytogenes [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2578-2587.
[13]	Dongliang LI, Guanmin ZHENG, Shuai LI, Hongsen ZHU, Chao WU. Differential Expression of Transcriptome in Jejunal of Piglets Infected with Porcine Epidemic Diarrhea Virus [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2652-2661.
[14]	CHONG Qian, ZHAO Xuehui, CAO Qing, XUE Huiwen, GOU Huitian. Research Progress of Applied Research on Listeria monocytogenes Phage [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(5): 1819-1826.
[15]	LI Jiannan, YUAN Liming, HUA Jinlian. Progress on the Application of CD46 in Breeding of Livestock for Disease Resistance [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(5): 1866-1874.

Transcriptome Sequencing was Used to Screen Genes Related to Follicular Development Bias and Dominant Follicle Selection in Cattle

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 12

References 40

Related Articles 15

Recommended Articles

Metrics

Comments