IGF1、CoQ10、MT联合添加缓解热应激对牛IVF囊胚的影响

doi:10.11843/j.issn.0366-6964.2024.06.019

Abstract

Abstract:

The aim of this study was to investigate the effects of combination of insulin-like growth factor 1 (IGF1), coenzyme Q10 (CoQ10), and melatonin (MT) on development of bovine oocytes, embryos and heat stressed blastocysts. In this study, bovine ovaries were collected from the abattoir and cumulus-oocyte complexes (COCs) were extracted in the laboratory. IGF1, CoQ10 and MT were added to bovine oocyte in vitro maturation (IVM) solution and bovine embryo in vitro culture (IVC) solution. The developmental ability, level of reactive oxygen species (ROS) and mitochondrial membrane potential (ΔΨm) of bovine oocytes from each treatment were detected. By applying 41 ℃ heat stress at the blastocyst stage, the effects of heat stress and combined supplementation on the developmental ability and apoptosis level of bovine IVF blastocysts were determined, and the mRNA expression levels of embryo quality related genes were detected by qRT-PCR. Each experimental group was repeated 3 times. The results showed that the combination of IGF1, CoQ10 and MT (ICM group) significantly increased oocyte maturation rate ((90.40±2.06)% vs. (65.41±0.63)%), cleavage rate ((93.33±1.96)% vs. (59.77±2.93)%) and blastocyst rate ((51.43±5.34)% vs. (26.92±3.24)%)) (P < 0.05) compared with the non added group (CT-0 group). In the ICM group, the ROS level of bovine oocytes was significantly decreased and the ΔΨm of bovine oocytes was significantly increased (P < 0.05). Compared with the heat stress group (HS group), the combination of IGF1, CoQ10 and MT (ICM+HS group) significantly increased expanding rate ((62.00±2.97)% vs. (30.77±8.66)%, P < 0.05) of heat stressed blastocysts, inhibited apoptosis of heat stressed blastocyst cells, and increased mRNA expression levels of IGFBP3, ATP1A1, DSC2, and IFNT2 (P < 0.05) of heat stressed blastocysts. In summary, the combination of IGF1, CoQ10 and MT can effectively enhance the developmental ability, reduce the ROS level and increase the ΔΨm of bovine oocytes. Heat stress reduced the expanding rate of bovine blastocysts, promoted apoptosis of bovine blastocyst cells and damaged the quality of blastocysts, while the combination of IGF1, CoQ10 and MT alleviated the damage from heat stress.

Key words: IGF1, CoQ10, melatonin, heat stress, dairy cow, embryo

CLC Number:

S823.3

Hang ZHANG, Peipei ZHANG, Baigao YANG, Xiaoyi FENG, Yifan NIU, Zhou YU, Jianhua CAO, Pengcheng WAN, Xueming ZHAO. Combination of IGF1, CoQ10 and MT Alleviated the Effects of Heat Stress on Bovine IVF Blastocysts[J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2474-2485.

Figures/Tables 8

Table 1

Table 2

Table 3

Fig. 1

Fig. 2

Table 4

Fig. 3

Fig. 4

References 64

1	DASHS,CHAKRAVARTYA K,SINGHA,et al.Effect of heat stress on reproductive performances of dairy cattle and buffaloes: a review[J].Vet World,2016,9(3):235-244. doi: 10.14202/vetworld.2016.235-244
2	KASIMANICKAMR,KASIMANICKAMV.Impact of heat stress on embryonic development during first 16 days of gestation in dairy cows[J].Sci Rep,2021,11(1):14839. doi: 10.1038/s41598-021-94278-2
3	MISHRAS R.Behavioural, physiological, neuro-endocrine and molecular responses of cattle against heat stress: an updated review[J].Trop Anim Health Prod,2021,53(3):400. doi: 10.1007/s11250-021-02790-4
4	THORNTONP,NELSONG,MAYBERRYD,et al.Impacts of heat stress on global cattle production during the 21st century: a modelling study[J].Lancet Planet Health,2022,6(3):e192-e201. doi: 10.1016/S2542-5196(22)00002-X
5	WANKARA K,RINDHES N,DOIJADN S.Heat stress in dairy animals and current milk production trends, economics, and future perspectives: the global scenario[J].Trop Anim Health Prod,2021,53(1):70. doi: 10.1007/s11250-020-02541-x
6	ROTHZ,WOLFENSOND.Comparing the effects of heat stress and mastitis on ovarian function in lactating cows: basic and applied aspects[J].Domest Anim Endocrinol,2016,56,S218-S227. doi: 10.1016/j.domaniend.2016.02.013
7	GENDELMANM,ROTHZ.Incorporation of coenzyme q10 into bovine oocytes improves mitochondrial features and alleviates the effects of summer thermal stress on developmental competence[J].Biol Reprod,2012,87(5):118.
8	ROTHZ.Effect of heat stress on reproduction in dairy cows: insights into the cellular and molecular responses of the oocyte[J].Annu Rev Anim Biosci,2017,5,151-170. doi: 10.1146/annurev-animal-022516-022849
9	BÁEZF,LÓPEZDARRIULAT R,RODRÍGUEZ-OSORION,et al.Effect of season on germinal vesicle stage, quality, and subsequent in vitro developmental competence in bovine cumulus-oocyte complexes[J].J Therm Biol,2022,103,103171. doi: 10.1016/j.jtherbio.2021.103171
10	CAMARGOL S A,AGUIRRE-LAVINT,ADENOTP,et al.Heat shock during in vitro maturation induces chromatin modifications in the bovine embryo[J].Reproduction,2019,158(4):313-322. doi: 10.1530/REP-19-0245
11	RIVERAR M,KELLEYK L,ERDOSG W,et al.Reorganization of microfilaments and microtubules by thermal stress in two-cell bovine embryos[J].Biol Reprod,2004,70(6):1852-1862. doi: 10.1095/biolreprod.103.024901
12	RIVERAR M,KELLEYK L,ERDOSG W,et al.Alterations in ultrastructural morphology of two-cell bovine embryos produced in vitro and in vivo following a physiologically relevant heat shock[J].Biol Reprod,2003,69(6):2068-2077. doi: 10.1095/biolreprod.103.020347
13	STAMPERNAK,DOVOLOUE,GIANNOULIST,et al.Developmental competence of heat stressed oocytes from Holstein and Limousine cows matured in vitro[J].Reprod Domest Anim,2021,56(10):1302-1314. doi: 10.1111/rda.13993
14	NANASI,CHOUZOURIST M,DOVOLOUE,et al.Early embryo losses, progesterone and pregnancy associated glycoproteins levels during summer heat stress in dairy cows[J].J Therm Biol,2021,98,102951. doi: 10.1016/j.jtherbio.2021.102951
15	STAMPERNAK,GIANNOULIST,DOVOLOUE,et al.The effects of heat shock protein 70 addition in the culture medium on the development and quality of in vitro produced heat shocked bovine embryos[J].Animals,2021,11(12):3347. doi: 10.3390/ani11123347
16	MI TKIEWSKAK,KORDOWITZKIP,PAREEKC S.Effects of heat stress on bovine oocytes and early embryonic development-an update[J].Cells,2022,11(24):4073. doi: 10.3390/cells11244073
17	LEPOCKJ R.How do cells respond to their thermal environment?[J].Int J Hyperthermia,2005,21(8):681-687. doi: 10.1080/02656730500307298
18	SAKATANIM,BONILLAL,DOBBSK B,et al.Changes in the transcriptome of morula-stage bovine embryos caused by heat shock: relationship to developmental acquisition of thermotolerance[J].Reprod Biol Endocrinol,2013,11,3. doi: 10.1186/1477-7827-11-3
19	HANSENP J.The incompletely fulfilled promise of embryo transfer in cattle-why aren't pregnancy rates greater and what can we do about it?[J].J Anim Sci,2020,98(11):skaa288. doi: 10.1093/jas/skaa288
20	STEWARTB M,BLOCKJ,MORELLIP,et al.Efficacy of embryo transfer in lactating dairy cows during summer using fresh or vitrified embryos produced in vitro with sex-sorted semen[J].J Dairy Sci,2011,94(7):3437-3445. doi: 10.3168/jds.2010-4008
21	ABDEL AZIZR L,HUSSEINM M,MOHAMEDM A A,et al.Heat stress during critical windows of the oestrous cycle and risk of pregnancy establishment in embryo-recipient dairy heifers[J].Reprod Domest Anim,2022,57(8):856-863. doi: 10.1111/rda.14128
22	KUROKIT,IKEDAS,OKADAT,et al.Astaxanthin ameliorates heat stress-induced impairment of blastocyst development in vitro: -astaxanthin colocalization with and action on mitochondria-[J].J Assist Reprod Genet,2013,30(5):623-631. doi: 10.1007/s10815-013-9987-z
23	MORIM,HAYASHIT,ISOZAKIY,et al.Heat shock decreases the embryonic quality of frozen-thawed bovine blastocysts produced in vitro[J].J Reprod Dev,2015,61(5):423-429. doi: 10.1262/jrd.2015-003
24	CHENGM B,WANGX,HUANGY,et al.Hyperthermia depletes Oct4 in mouse blastocysts and stem cells[J].Stem Cell Res Ther,2020,11(1):195. doi: 10.1186/s13287-020-01715-6
25	BLOCKJ,HANSENP J.Interaction between season and culture with insulin-like growth factor-1 on survival of in vitro produced embryos following transfer to lactating dairy cows[J].Theriogenology,2007,67(9):1518-1529. doi: 10.1016/j.theriogenology.2007.03.012
26	JOUSANF D,OLIVEIRAL J,HANSENP J.Short-Term culture of in vitro produced bovine preimplantation embryos with insulin-like growth factor-I prevents heat shock-induced apoptosis through activation of the Phosphatidylinositol 3-Kinase/Akt pathway[J].Mol Reprod Dev,2008,75(4):681-688. doi: 10.1002/mrd.20830
27	JOUSANF D,HANSENP J.Insulin-like growth factor-I promotes resistance of bovine preimplantation embryos to heat shock through actions independent of its anti-apoptotic actions requiring PI3K signaling[J].Mol Reprod Dev,2007,74(2):189-196. doi: 10.1002/mrd.20527
28	JOUSANF D,HANSENP J.Insulin-like growth factor-I as a survival factor for the bovine preimplantation embryo exposed to heat shock[J].Biol Reprod,2004,71(5):1665-1670. doi: 10.1095/biolreprod.104.032102
29	ABDULHASANM K,LIQ,DAIJ,et al.CoQ10 increases mitochondrial mass and polarization, ATP and Oct4 potency levels, and bovine oocyte MⅡ during IVM while decreasing AMPK activity and oocyte death[J].J Assist Reprod Genet,2017,34(12):1595-1607. doi: 10.1007/s10815-017-1027-y
30	YANGC X,LIUS,MIAOJ K,et al.CoQ10 improves meiotic maturation of pig oocytes through enhancing mitochondrial function and suppressing oxidative stress[J].Theriogenology,2021,159,77-86. doi: 10.1016/j.theriogenology.2020.10.009
31	LEEC H,KANGM K,SOHND H,et al.Coenzyme Q10 ameliorates the quality of mouse oocytes during in vitro culture[J].Zygote,2022,30(2):249-257. doi: 10.1017/S0967199421000617
32	DE CASTRO CAVALLARIF,LEALC L V,ZVIR,et al.Effects of melatonin on production of reactive oxygen species and developmental competence of bovine oocytes exposed to heat shock and oxidative stress during in vitro maturation[J].Zygote,2019,27(3):180-186. doi: 10.1017/S0967199419000236
33	CEBRIAN-SERRANOA,SALVADORI,RAGAE,et al.Beneficial effect of melatonin on blastocyst in vitro production from heat-stressed bovine oocytes[J].Reprod Domest Anim,2013,48(5):738-746. doi: 10.1111/rda.12154
34	BONILLAA Q S,OLIVEIRAL J,OZAWAM,et al.Developmental changes in thermoprotective actions of insulin-like growth factor-1 on the preimplantation bovine embryo[J].Mol Cell Endocrinol,2011,332(1/2):170-179.
35	YAACOBI-ARTZIS,SHIMONIC,KALOD,et al.Melatonin slightly alleviates the effect of heat shock on bovine oocytes and resulting blastocysts[J].Theriogenology,2020,158,477-489. doi: 10.1016/j.theriogenology.2020.09.039
36	BLOCKJ,WRENZYCKIC,NIEMANNH,et al.Effects of insulin-like growth factor-1 on cellular and molecular characteristics of bovine blastocysts produced in vitro[J].Mol Reprod Dev,2008,75(5):895-903. doi: 10.1002/mrd.20826
37	BRACKETTB G,OLIPHANTG.Capacitation of rabbit spermatozoa in vitro[J].Biol Reprod,1975,12(2):260-274. doi: 10.1095/biolreprod12.2.260
38	RIVERAR M,HANSENP J.Development of cultured bovine embryos after exposure to high temperatures in the physiological range[J].Reproduction,2001,121(1):107-115. doi: 10.1530/rep.0.1210107
39	YANGS,YANGY Z,HAOH S,et al.Supplementation of EGF, IGF-1, and Connexin 37 in IVM medium significantly improved the maturation of bovine oocytes and vitrification of their IVF blastocysts[J].Genes (Basel),2022,13(5):805. doi: 10.3390/genes13050805
40	MADDAHIA,SABERIVANDA,HAMALIH,et al.Exploring the impact of heat stress on oocyte maturation and embryo development in dairy cattle using a culture medium supplemented with vitamins E, C, and coenzyme Q10[J].J Therm Biol,2024,119,103759. doi: 10.1016/j.jtherbio.2023.103759
41	GUTIÉRREZ-AÑEZJ C,HENNINGH,LUCAS-HAHNA,et al.Melatonin improves rate of monospermic fertilization and early embryo development in a bovine IVF system[J].PLoS One,2021,16(9):e0256701. doi: 10.1371/journal.pone.0256701
42	EL-SHEIKHM,MESALAMA A,SONGS H,et al.Melatonin alleviates the toxicity of high nicotinamide concentrations in oocytes: potential interaction with nicotinamide methylation signaling[J].Oxid Med Cell Longev,2021,2021,5573357.
43	SAKAGUCHIM,DOMINKOT,YAMAUCHIN,et al.Possible mechanism for acceleration of meiotic progression of bovine follicular oocytes by growth factors in vitro[J].Reproduction,2002,123(1):135-142. doi: 10.1530/rep.0.1230135
44	BONILLAA Q S,OZAWAM,HANSENP J.Timing and dependence upon mitogen-activated protein kinase signaling for pro-developmental actions of insulin-like growth factor 1 on the preimplantation bovine embryo[J].Growth Horm IGF Res,2011,21(2):107-111. doi: 10.1016/j.ghir.2011.03.003
45	ZHAOX M,WANGN,HAOH S,et al.Melatonin improves the fertilization capacity and developmental ability of bovine oocytes by regulating cytoplasmic maturation events[J].J Pineal Res,2018,64(1):e12445. doi: 10.1111/jpi.12445
46	SUJ M,WANGY S,XINGX P,et al.Melatonin significantly improves the developmental competence of bovine somatic cell nuclear transfer embryos[J].J Pineal Res,2015,59(4):455-468. doi: 10.1111/jpi.12275
47	RODRÍGUEZ-NUEVOA,TORRES-SANCHEZA,DURANJ M,et al.Oocytes maintain ROS-free mitochondrial metabolism by suppressing complex I[J].Nature,2022,607(7920):756-761. doi: 10.1038/s41586-022-04979-5
48	VAN DER REESTJ,NARDINI CECCHINOG,HAIGISM C,et al.Mitochondria: their relevance during oocyte ageing[J].Ageing Res Rev,2021,70,101378. doi: 10.1016/j.arr.2021.101378
49	YANGM H,TAOJ L,CHAIM L,et al.Melatonin improves the quality of inferior bovine oocytes and promoted their subsequent IVF embryo development: mechanisms and results[J].Molecules,2017,22(12):2059. doi: 10.3390/molecules22122059
50	KIRILLOVAA,SMITZJ E J,SUKHIKHG T,et al.The role of mitochondria in oocyte maturation[J].Cells,2021,10(9):2484. doi: 10.3390/cells10092484
51	ADHIKARID,LEEI W,YUENW S,et al.Oocyte mitochondria-key regulators of oocyte function and potential therapeutic targets for improving fertility[J].Biol Reprod,2022,106(2):366-377. doi: 10.1093/biolre/ioac024
52	AL-ZUBAIDIU,LIUJ,CINARO,et al.The spatio-temporal dynamics of mitochondrial membrane potential during oocyte maturation[J].Mol Hum Reprod,2019,25(11):695-705. doi: 10.1093/molehr/gaz055
53	GIROTOA B,FONTESP K,FRANCHIF F,et al.Use of pregnancy-associated plasma protein-A during oocyte in vitro maturation increases IGF-1 and affects the transcriptional profile of cumulus cells and embryos from Nelore cows[J].Mol Reprod Dev,2019,86(11):1694-1704. doi: 10.1002/mrd.23259
54	ASCARII J,ALVESN G,JASMINJ,et al.Addition of insulin-like growth factor I to the maturation medium of bovine oocytes subjected to heat shock: effects on the production of reactive oxygen species, mitochondrial activity and oocyte competence[J].Domest Anim Endocrin,2017,60,50-60. doi: 10.1016/j.domaniend.2017.03.003
55	HEYDARNEJADA,OSTADHOSSEINIS,VARNOSFADERANIS R,et al.Supplementation of maturation medium with CoQ10 enhances developmental competence of ovine oocytes through improvement of mitochondrial function[J].Mol Reprod Dev,2019,86(7):812-824. doi: 10.1002/mrd.23159
56	ZHAOX M,HAOH S,DUW H,et al.Melatonin inhibits apoptosis and improves the developmental potential of vitrified bovine oocytes[J].J Pineal Res,2016,60(2):132-141. doi: 10.1111/jpi.12290
57	PANGY W,ZHAOS J,SUNY Q,et al.Protective effects of melatonin on the in vitro developmental competence of bovine oocytes[J].Anim Sci J,2018,89(4):648-660. doi: 10.1111/asj.12970
58	RYAND P,BLAKEWOODE G,LYNNJ W,et al.Effect of heat-stress on bovine embryo development in vitro[J].J Anim Sci,1992,70(11):3490-3497. doi: 10.2527/1992.70113490x
59	STOJKOVICM,WESTESENK,ZAKHARTCHENKOV,et al.Coenzyme Q₁₀ in submicron-sized dispersion improves development, hatching, cell proliferation, and adenosine triphosphate content of in vitro-produced bovine embryos[J].Biol Reprod,1999,61(2):541-547. doi: 10.1095/biolreprod61.2.541
60	ORTEGAM S,ROCHA-FRIGONIN A S,MINGOTIG Z,et al.Modification of embryonic resistance to heat shock in cattle by melatonin and genetic variation in HSPA1L[J].J Dairy Sci,2016,99(11):9152-9164. doi: 10.3168/jds.2016-11501
61	WATSONA J,NATALED R,BARCROFTL C.Molecular regulation of blastocyst formation[J].Anim Reprod Sci,2004,82-83,583-592. doi: 10.1016/j.anireprosci.2004.04.004
62	COLLINSJ E,LORIMERJ E,GARRODD R,et al.Regulation of desmocollin transcription in mouse preimplantation embryos[J].Development,1995,121(3):743-753. doi: 10.1242/dev.121.3.743
63	RIZOSD,GUTIÉRREZ-ADÁNA,PÉREZ-GARNELOS,et al.Bovine embryo culture in the presence or absence of serum: implications for blastocyst development, cryotolerance, and messenger RNA expression[J].Biol Reprod,2003,68(1):236-243. doi: 10.1095/biolreprod.102.007799
64	KHATUNH,EGASHIRAJ,SAKATANIM,et al.Sericin enhances the developmental competence of heat-stressed bovine embryos[J].Mol Reprod Dev,2018,85(8-9):696-708. doi: 10.1002/mrd.23038

组别 Group	体外成熟处理 In vitro maturation treatment	体外培养处理 In vitro culture treatment	热应激处理 Heat stress treatment
CT-0	—	—	—
CT-I	IGF1	—	—
IC	IGF1+CoQ10	IGF1+CoQ10	—
IM	IGF1+MT	IGF1+MT	—
ICM	IGF1+CoQ10+MT	IGF1+CoQ10+MT	—
HS	IGF1	—	41 ℃ 12 h
ICM+HS	IGF1+CoQ10+MT	IGF1+CoQ10+MT	41 ℃ 12 h

基因 Gene	引物(5′→3′) Primer	长度/bp Size	序列号 GenBank Accession No.
IGFBP3	F: AAAATCGCCCTTGCTTGGTG	188	NM_174556.1
	R: CTCGGTCGTGGCTGTGTTT
ATP1A1	F: CCTAGCTCCTTCCTCTTCGCTC	181	NM_001076798.1
	R: CTTGTCCCCATGCTCTGAAACA
DSC2	F: AAGCATACGACCCGGAAACA	86	NM_001166526.1
	R: TTCATCCACATCGACCCACC
IFNT2	F: CTCTCCTCATCCCTGTCTGC	83	NM_001015511.4
	R: GATCCTTCTGGAGCTGGTTG
β-actin	F: ACTTGCGCAGAAAACGAGAT	121	NM_173979.3
	R: CACCTTCACCGTTCCAGTTT

组别 Group	成熟率/% Maturation rate	卵裂率/% Cleavage rate	囊胚率/% Blastocyst rate
CT-0	65.41±0.63(121/185)^d	59.77±2.93(52/87)^d	26.92±3.24(14/52)^c
CT-I	71.01±0.72(120/169)^c	70.33±3.19(64/91)^c	37.50±2.50(24/64)^b
IC	85.60±2.12(107/125)^b	87.50±5.39(63/72)^ab	47.62±2.81(30/63)^a
IM	84.38±2.65(108/128)^b	86.49±3.25(64/74)^b	45.31±4.22(29/64)^a
ICM	90.40±2.06(113/125)^a	93.33±1.96(70/75)^a	51.43±5.34(36/70)^a

组别 Group	卵裂率/% Cleavage rate	囊胚率/% Blastocyst rate	囊胚扩张率/% Expanding rate
CT-I	75.37±6.29(101/134)^b	31.69±0.48(32/101)^b	82.76±3.91(24/29)^a
HS	75.63±2.95(90/119)^b	32.22±1.92(29/90)^b	30.77±8.66(4/13)^c
ICM+HS	93.45±3.50(157/168)^a	49.68±2.04(78/157)^a	62.00±2.97(31/50)^b

[1]	Xinrui ZHANG, Yu FU, Sijia MA, Zhuo YANG, Jinzhong TAO. Physiological Regulation and Feeding Management of Periparturient Dairy Cows [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2325-2333.
[2]	Ying CHEN, Dayong CHEN, Riga WU, Chunjuan QIU, Lihong FAN, Meirong BAO, Yuan YUE, Hongyan LIANG, Jiaxin ZHANG, Jianhui TIAN, Lei AN, Liqin WANG. Influence of Meat Sheep Varieties on the Scale Application of in vitro Embryo Production Technology [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2451-2459.
[3]	Xiaoyi FENG, Peipei ZHANG, Hang ZHANG, Haisheng HAO, Weihua DU, Huabin ZHU, Kai CUI, Xueming ZHAO. Effects of Heat Stress on Epigenetic Modifications and Developmental Competence of Bovine Oocytes and Their Embryos [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2460-2473.
[4]	Kaihui WU, Liuguang ZHANG, Chao WANG, Shiyuan XU, Songqi LIU, Kaimin YUAN, Dong WANG, Yunwei PANG. Study on the Mechanism of Melatonin Relieving Testicular Damage in Mice Induced Busulfan [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2486-2497.
[5]	Ji WANG, Xinyan ZHOU, Fangrui GUO, Qiurong XU, Dongyi WU, Yan MAO, Zhihang YUAN, Jin'e YI, Lixin WEN, Jing WU. Viola yedoensis Makino Improves the Growth Performance, Meat Quality, and Gut Microbiota of Broilers Exposed to Heat Stress [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2761-2774.
[6]	XIANG Hui, GUI Linsen, YANG Di, WEI Shihao, GONG Yanbin, SHI Yuangang, MA Yun, DAN Xingang. Research Progress on the Estrus Synchronization-fixed-timed Artificial Insemination Technology in Dairy Cows [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(4): 1412-1422.
[7]	LAN Xinrui, ZHAO Baobao, ZHANG Bihan, LIN Xiaoyu, MA Huiming, WANG Yongsheng. Effects of β-sitosterol on Porcine Oocyte Maturation and Embryonic Development in Vitro [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(4): 1629-1637.
[8]	WANG Xiao, ZHANG Hao, LUAN Qingjiang, LI Hui, YANG Ding, WANG Tingyue, TIAN Jing, ZHAO Meng, CHEN Lu, TIAN Rugang. A Comprehensive Review of the Impact of Cold and Heat Stress on the Physiological Parameters and Gene Expression in Beef Cattle [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(3): 894-904.
[9]	LI Yujun, HE Honghong, YANG Lixue, YANG Xiaogeng, LI Jian, ZHANG Huizhu. Advances in Regulation of Mammalian Embryonic Development by Mitochondrial Autophagy [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(3): 905-912.
[10]	ZHANG Xinrui, FU Yu, YANG Zhuo, SHEN Wenjuan, TAO Jinzhong. Study of Early Pregnancy Diagnostic Proteins in Dairy Cows [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(2): 451-460.
[11]	HUO Yuannan, QIU Meijia, ZHANG Jiaojiao, YANG Weirong, WANG Xianzhong. Arginine and Its Metabolites Attenuate Heat Stress-induced Apoptosis of Immature Boar Sertoli Cells [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(2): 587-597.
[12]	GAO Yawei, PENG Di, SUN Zhaoyang, YAN Ziyue, CUI Kai, MA Zefang. Mining the Molecular Mechanism of Exogenous Melatonin Affecting the Development of Mink Ovary Based on Transcriptome Data [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(2): 607-618.
[13]	XIAO Yimei, WANG Shengnan, XU Yuewen, HE Xiaolin, YIN Fuquan. Research on the Influence of Heat Stress on Male Reproduction [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(1): 11-21.
[14]	ZHANG Chenjian, LI Yinxia, DING Qiang, LIU Weijia, WANG Huili, HE Nan, WU Jiashun, CAO Shaoxian. Efficient Preparation of CRISPR/Cas9-mediated Goat SOCS2 Gene Edited Embryos [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(1): 129-141.
[15]	CHEN Yuetong, LIU Xiaohan, WANG Zhiyang, ZHAO Yuxin, ZHOU Tiezhong, HU Zengjin, ZHU Yue, WANG Shaohui, TIAN Mingxing, DING Siyu, QI Jingjing, YU Shengqing. Isolation, Identification, Pathogenicity and Drug Susceptibility of Mycoplasma gallisepticum from Dead Chicken Embryos in Large-scale Chicken Farms in Guangdong Province [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(1): 290-299.

Combination of IGF1, CoQ10 and MT Alleviated the Effects of Heat Stress on Bovine IVF Blastocysts

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 8

References 64

Related Articles 15

Recommended Articles

Metrics

Comments