Acta Veterinaria et Zootechnica Sinica ›› 2024, Vol. 55 ›› Issue (6): 2761-2774.doi: 10.11843/j.issn.0366-6964.2024.06.046
• Clinical Veterinary Medicine • Previous Articles
Ji WANG1,2(), Xinyan ZHOU1(
), Fangrui GUO1, Qiurong XU1, Dongyi WU1, Yan MAO1, Zhihang YUAN1, Jin'e YI1, Lixin WEN1, Jing WU1,*(
)
Received:
2023-08-23
Online:
2024-06-23
Published:
2024-06-28
Contact:
Jing WU
E-mail:wangjics@163.com;zxy1085082373@163.com;wujing@hunau.edu.cn
CLC Number:
Ji WANG, Xinyan ZHOU, Fangrui GUO, Qiurong XU, Dongyi WU, Yan MAO, Zhihang YUAN, Jin'e YI, Lixin WEN, Jing WU. Viola yedoensis Makino Improves the Growth Performance, Meat Quality, and Gut Microbiota of Broilers Exposed to Heat Stress[J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2761-2774.
Table 1
Composition and the nutrient levels of the basal diets in study"
项目Item | 含量/% Content | |
1~21天 1 to 21days | 22~42天 22 to42 days | |
日粮组成Ingredient | ||
玉米Corn | 57 | 61.5 |
豆粕Soybean meal | 31 | 24.5 |
鱼粉Fish meal | 4 | 5 |
豆油Soybean oil | 4 | 5 |
磷酸氢钙CaHPO4 | 1.47 | 1.37 |
石粉Limestone | 0.9 | 1 |
L-赖氨酸L-Lysine | 0.25 | 0.3 |
蛋氨酸Methionine | 0.2 | 0.15 |
苏氨酸Threonine | 0.15 | 0.15 |
50%氯化胆碱 Choline chloride (50%) | 0.2 | 0.2 |
氯化钠NaCl | 0.3 | 0.3 |
多维多矿 Multivitamin-mineral | 0.03 | 0.03 |
预混料Premix | 0.5 | 0.5 |
总计Total | 100 | 100 |
营养水平Nutrient levels | ||
代谢能/(MJ·kg-1) Metabolism energy | 12.77 | 13.21 |
粗蛋白Crude protein | 20.86 | 19.11 |
钙Ca | 1.03 | 1.02 |
有效磷Digestible P | 0.47 | 0.43 |
赖氨酸Lysine | 1.43 | 1.34 |
蛋氨酸Methionine | 0.54 | 0.47 |
苏氨酸Threonine | 0.96 | 0.87 |
精氨酸Arginine | 1.49 | 1.3 |
蛋氨酸+半胱氨酸 Methionine+cysteine | 0.87 | 0.77 |
Table 2
Primer sequences for PCR analysis"
基因 Gene name | 引物序列(5′→3′) Primer sequences (5′→3′) | 登录号 Accession number |
β-actin | F: CGTGACCTGACGGACTACCT R: TGCTCGAAATCCAGTGCGAC | NM_205518.2 |
Hsp70 | F: CGGGCAAGTTTGACCTAA R: TTGGCTCCCACCCTATCTCT | NM_001006685.1 |
Pparα | F: GAATCACCCAGTGGAGCAG R: CAGTATTGGCACTTATTACGA | NM_001001464.1 |
Fatp1 | F: CGGTGCTGTTACGAGTGA R: CACGGCGTTGGAATACTT | NM_001039602 |
B0at1 | F: TACAGTGGTGGCTTCTGTTATG R: GGTATGGAAGAGTCGACGTTATG | XM_040663289.1 |
Pept1 | F: TCACTGTTGGCATGTTCCT R: TTCGCATTGCTATCACCTA | NM_204365.2 |
Cat1 | F: TGGATACCAACAGCCCATTAC R: GCCAAGGAGACTCGTAGAAAG | NM_001398060.1 |
Eaat3 | F: AAGTTGAGGACTGGGAAAT R: ATGAGGGCTGTCAGAAGTG | XM_424930.7 |
Myf5 | F: GGAGGAGGCTGAAGAAAGTG R: ATGTACCTGATGGCGTTCCT | NM_001030363.2 |
Pax3 | F: ACTACCCTGACATTTATACTCG R: TGCCTGCTTCCTCCATCTAG | NM_001397759.1 |
Pax7 | F: AGGCTGACTTCTCCATCTCTCCT R: TGTAACTGGTGGTGCTGTAGGTG | XM_025142486.2 |
Myog | F: GGAGAAGCGGAGGCTGAAG R: GCAGAGTGCTGCGTTTCAGA | NM_204184.2 |
Myod | F: CCAAAGCATGGGAAGAGTTC R: GCAGTATGGGACATGTGGAG | NM_204214.3 |
Fig. 1
Effects of Viola yedoensis Makino on serum HSP70 concentration and growth performance in heat-stressed broilers A. Schematic of the experimental design; B. Serum HSP70 concentration; C. Body weight from 1 to 42 days old; D. Body weight of chickens at 1, 28 and 42 days of age; E. Body weight gain; F. Feed intake; G. Feed to gain ratio. Bars with different letters represent statistically significant differences(P < 0.05), while with no letter or same letter represent no significant difference(P > 0.05). The same as below"
Table 3
Effects of Viola yedoensis Makino on serum biochemical indexes in heat-stressed broilers"
分组Group | GLO/(g·L-1) | ALB/(g·L-1) | LDH/(U·L-1) | CK/(U·L-1) |
NT | 18.45±0.74ab | 10.84±0.38b | 2 134.36±263.53b | 2 985.03±311.13b |
NT+VYM-H | 18.56±0.82ab | 10.48±0.60ab | 1 582.32±219.12a | 2 335.51±317.49a |
HS | 17.36±1.68a | 10.24±0.55a | 1 973.28±549.83b | 3 650.86±540.60c |
HS+VYM-L | 17.21±0.87ab | 10.41±0.26ab | 1 952.88±130.75b | 2 829.45±727.11b |
HS+VYM-M | 18.74±1.28b | 10.61±0.57ab | 1 814.19±195.90b | 2 659.46±457.50b |
HS+VYM-H | 18.28±1.14ab | 10.51±0.53ab | 1 868.22±239.40ab | 2 938.07±723.59b |
Fig. 2
Effects of Viola yedoensis Makino on meat quality and the gene expression levels related to breast muscle fiber regulation in heat-stressed broilers A. Meat color; B. Meat pH; C. Shearing force of breast muscle; D. Drip loss of breast muscle; E. Cooking loss of breast muscle. F-J. mRNA levels of Pax3, Pax7, Myog, Myod, Myf5 in breast muscle, respectively; K. Breast muscle fiber diameters (100×); L. HE staining of breast muscles"
Fig. 3
Effects of Viola yedoensis Makino on the morphology, digestive enzymes activity, relative mRNA expression of Hsp70, and major nutrient transporter genes in broiler duodenum A. HE staining of duodenum (20×); B. HE staining of duodenum (enlarge the box section in A, 100×); C. PAS staining of duodenum (50×); D. Villus/crypt ratio of duodenum; E. mRNA expression of Hsp70; F. Amylase activity; G. Lipase activity; H-M. mRNA expression of Pparα, Fatp1, B0at1, Pept1, Cat1, and Eaat3 gene in broiler duodenum, respectively"
Fig. 4
Effects of Viola yedoensis Makino on the species richness and diversity of intestinal microbiota at OTU level A. Sobs index; B. Shannon index; C. Shannoneven index; D. Venn diagrams; E. PCoA; F. ANOSIM analysis among groups; (G-H) Percent of community abundance at phylum, and genus levels. * P < 0.05, ** P < 0.01, the same as below"
Fig. 6
Effects of heat stress and Viola yedoensis Makino on species richness differences at genus level A-F. Relative abundances of Ruminococcus_torques_group, Lactobacillus, Enterococcus, CHKCI001, norank_f__Ruminococcaceae and Weissella, respectively. G-L. Relative abundances of unclassified_f__Lachnospiraceae, Bacteroides, Eisenbergiella, Bilophila, Subdoligranulum and Butyricicoccus, respectively"
1 |
HABASHY W S , MILFORT M C , ADOMAKO K , et al. Effect of heat stress on amino acid digestibility and transporters in meat-type chickens[J]. Poult Sci, 2017, 96 (7): 2312- 2319.
doi: 10.3382/ps/pex027 |
2 | HE Y Q , MALTECCA C , TIEZZI F . Potential use of gut microbiota composition as a biomarker of heat stress in monogastric species: a review[J]. Animals (Basel), 2021, 11 (6): 1833. |
3 |
TANG L P , LIU Y L , ZHANG J X , et al. Heat stress in broilers of liver injury effects of heat stress on oxidative stress and autophagy in liver of broilers[J]. Poult Sci, 2022, 101 (10): 102085.
doi: 10.1016/j.psj.2022.102085 |
4 |
TAVANIELLO S , SLAWINSKA A , SIRRI F , et al. Performance and meat quality traits of slow-growing chickens stimulated in ovo with galactooligosaccharides and exposed to heat stress[J]. Poult Sci, 2022, 101 (8): 101972.
doi: 10.1016/j.psj.2022.101972 |
5 |
LI Q F , ZHOU H , OUYANG J X , et al. Effects of dietary tryptophan supplementation on body temperature, hormone, and cytokine levels in broilers exposed to acute heat stress[J]. Trop Anim Health Prod, 2022, 54 (3): 164.
doi: 10.1007/s11250-022-03161-3 |
6 |
SHI D Y , BAI L , QU Q , et al. Impact of gut microbiota structure in heat-stressed broilers[J]. Poult Sci, 2019, 98 (6): 2405- 2413.
doi: 10.3382/ps/pez026 |
7 | YANG T , LIU B F , WANG Y J , et al. Ellagic acid improves antioxidant capacity and intestinal barrier function of heat-stressed broilers via regulating gut microbiota[J]. Animals (Basel), 2022, 12 (9): 1180. |
8 |
ZHANG L , ZHONG G , GU W J , et al. Dietary supplementation with daidzein and Chinese herbs, independently and combined, improves laying performance, egg quality and plasma hormone levels of post-peak laying hens[J]. Poult Sci, 2021, 100 (6): 101115.
doi: 10.1016/j.psj.2021.101115 |
9 |
SUN K X , WU L G J , WANG S Y , et al. Antitumor effects of Chinese herbal medicine compounds and their nano-formulations on regulating the immune system microenvironment[J]. Front Oncol, 2022, 12, 949332.
doi: 10.3389/fonc.2022.949332 |
10 |
LIU H W , ZHOU D W , TONG J M , et al. Influence of chestnut tannins on welfare, carcass characteristics, meat quality, and lipid oxidation in rabbits under high ambient temperature[J]. Meat Sci, 2012, 90 (1): 164- 169.
doi: 10.1016/j.meatsci.2011.06.019 |
11 |
WANG L , PIAO X L , KIM S W , et al. Effects of Forsythia suspensa extract on growth performance, nutrient digestibility, and antioxidant activities in broiler chickens under high ambient temperature[J]. Poult Sci, 2008, 87 (7): 1287- 1294.
doi: 10.3382/ps.2008-00023 |
12 |
LI H G , ZHAO J S , DENG W , et al. Effects of chlorogenic acid-enriched extract from Eucommia ulmoides Oliver leaf on growth performance and quality and oxidative status of meat in finishing pigs fed diets containing fresh or oxidized corn oil[J]. J Anim Physiol Anim Nutr (Berl), 2020, 104 (4): 1116- 1125.
doi: 10.1111/jpn.13267 |
13 |
CHU H Q , WANG J X , WANG Q , et al. Protective effect of n-Butanol extract from Viola yedoensis on immunological liver injury[J]. Chem Biodivers, 2021, 18 (6): e2001043.
doi: 10.1002/cbdv.202001043 |
14 |
CAO D L , ZHANG X J , XIE S Q , et al. Application of chloroplast genome in the identification of Traditional Chinese Medicine Viola philippica[J]. BMC Genomics, 2022, 23 (1): 540.
doi: 10.1186/s12864-022-08727-x |
15 |
ZENG H R , ZHAO B , ZHANG D , et al. Viola yedoensis Makino formula alleviates DNCB-induced atopic dermatitis by activating JAK2/STAT3 signaling pathway and promoting M2 macrophages polarization[J]. Phytomedicine, 2022, 103, 154228.
doi: 10.1016/j.phymed.2022.154228 |
16 |
WANG C K L , COLGRAVE M L , GUSTAFSON K R , et al. Anti-HIV cyclotides from the Chinese medicinal herb Viola yedoensis[J]. J Nat Prod, 2008, 71 (1): 47- 52.
doi: 10.1021/np070393g |
17 |
WANG X L , LIU X Y , LIU S , et al. Effects of anti-stress agents on the growth performance and immune function in broiler chickens with vaccination-induced stress[J]. Avian Pathol, 2023, 52 (1): 12- 24.
doi: 10.1080/03079457.2022.2114874 |
18 |
ZHANG L Y , LI X , LIU X Y , et al. Purified diet versus whole food diet and the inconsistent results in studies using animal models[J]. Food Funct, 2022, 13 (8): 4286- 4301.
doi: 10.1039/D1FO04311K |
19 |
SIDDIQUI S H , KANG D , PARK J , et al. Chronic heat stress regulates the relation between heat shock protein and immunity in broiler small intestine[J]. Sci Rep, 2020, 10 (1): 18872.
doi: 10.1038/s41598-020-75885-x |
20 |
DANGI S S , GUPTA M , NAGAR V , et al. Impact of short-term heat stress on physiological responses and expression profile of HSPs in Barbari goats[J]. Int J Biometeorol, 2014, 58 (10): 2085- 2093.
doi: 10.1007/s00484-014-0809-5 |
21 |
WANG Y , ZHAO H J , LIU J J , et al. Copper and arsenic-induced oxidative stress and immune imbalance are associated with activation of heat shock proteins in chicken intestines[J]. Int Immunopharmacol,, 2018, 60, 64- 75.
doi: 10.1016/j.intimp.2018.04.038 |
22 | ABDELNOUR S A , AL-GABRI N A , HASHEM N M , et al. Supplementation with proline improves haemato-biochemical and reproductive indicators in male rabbits affected by environmental heat-stress[J]. Animals (Basel), 2021, 11 (2): 373. |
23 |
DENG S L , LIU R , LI C B , et al. Meat quality and flavor compounds of soft-boiled chickens: effect of Chinese yellow-feathered chicken breed and slaughter age[J]. Poult Sci, 2022, 101 (12): 102168.
doi: 10.1016/j.psj.2022.102168 |
24 |
KIM H J , KIM H J , JEON J J , et al. Comparison of the quality characteristics of chicken breast meat from conventional and animal welfare farms under refrigerated storage[J]. Poult Sci, 2020, 99 (3): 1788- 1796.
doi: 10.1016/j.psj.2019.12.009 |
25 |
ULMAN A , KOT M , SKRZYPEK K , et al. Myogenic differentiation of iPS cells shows different efficiency in simultaneous comparison of protocols[J]. Cells, 2021, 10 (7): 1671.
doi: 10.3390/cells10071671 |
26 |
SOSA P , ALCALDE-ESTÉVEZ E , ASENJO-BUENO A , et al. Aging-related hyperphosphatemia impairs myogenic differentiation and enhances fibrosis in skeletal muscle[J]. J Cachexia Sarcopenia Muscle, 2021, 12 (5): 1266- 1279.
doi: 10.1002/jcsm.12750 |
27 |
DUNN A J , ANDO T , BROWN R F , et al. HPA axis activation and neurochemical responses to bacterial translocation from the gastrointestinal tract[J]. Ann N Y Acad Sci, 2003, 992 (1): 21- 29.
doi: 10.1111/j.1749-6632.2003.tb03134.x |
28 |
ARTHUR S , MANOHARAN P , SUNDARAM S , et al. Unique regulation of enterocyte brush border membrane Na-glutamine and Na-alanine Co-transport by peroxynitrite during chronic intestinal inflammation[J]. Int J Mol Sci, 2019, 20 (6): 1504.
doi: 10.3390/ijms20061504 |
29 |
CHEN Z G , ZHOU L H , YUAN Q L , et al. Effect of fumonisin B1 on oxidative stress and gene expression alteration of nutrient transporters in porcine intestinal cells[J]. J Biochem Mol Toxicol, 2021, 35 (4): e22706.
doi: 10.1002/jbt.22706 |
30 |
CHRISTOFIDES A , KONSTANTINIDOU E , JANI C , et al. The role of peroxisome proliferator-activated receptors (PPAR) in immune responses[J]. Metabolism, 2021, 114, 154338.
doi: 10.1016/j.metabol.2020.154338 |
31 |
ZHOU B L , YUAN Y T , ZHANG S S , et al. Intestinal flora and disease mutually shape the regional immune system in the intestinal tract[J]. Front Immunol, 2020, 11, 575.
doi: 10.3389/fimmu.2020.00575 |
32 | DOMINGO J J S , SÁNCHEZ C S . From the intestinal flora to the microbiome[J]. Rev Esp Enferm Dig, 2018, 110 (1): 51- 56. |
33 |
HILLS R D , PONTEFRACT B A , MISHCON H R , et al. Gut microbiome: profound implications for diet and disease[J]. Nutrients, 2019, 11 (7): 1613.
doi: 10.3390/nu11071613 |
34 | MILANI C , DURANTI S , BOTTACINI F , et al. The first microbial colonizers of the human gut: composition, activities, and health implications of the infant gut microbiota[J]. Microbiol Mol Biol Rev, 2017, 81 (4): e00036- 17. |
35 |
ROSTAGNO M H . Effects of heat stress on the gut health of poultry[J]. J Anim Sci, 2020, 98 (4): skaa090.
doi: 10.1093/jas/skaa090 |
36 |
CLAVIJO V , FLÓREZ M J V . The gastrointestinal microbiome and its association with the control of pathogens in broiler chicken production: A review[J]. Poult Sci, 2018, 97 (3): 1006- 1021.
doi: 10.3382/ps/pex359 |
37 |
LEY R E , TURNBAUGH P J , KLEIN S , et al. Microbial ecology: human gut microbes associated with obesity[J]. Nature, 2006, 444 (7122): 1022- 1023.
doi: 10.1038/4441022a |
38 |
TURNBAUGH P J , LEY R E , MAHOWALD M A , et al. An obesity-associated gut microbiome with increased capacity for energy harvest[J]. Nature, 2006, 444 (7122): 1027- 1031.
doi: 10.1038/nature05414 |
39 | SPANIER B , ROHM F . Proton coupled oligopeptide transporter 1 (PepT1) function, regulation, and influence on the intestinal homeostasis[J]. Compr Physiol, 2018, 8 (2): 843- 869. |
40 |
BRÖER S . The role of the neutral amino acid transporter B0AT1 (SLC6A19) in Hartnup disorder and protein nutrition[J]. IUBMB Life, 2009, 61 (6): 591- 599.
doi: 10.1002/iub.210 |
41 |
BIANCHI M G , BARDELLI D , CHIU M , et al. Changes in the expression of the glutamate transporter EAAT3/EAAC1 in health and disease[J]. Cell Mol Life Sci, 2014, 71 (11): 2001- 2015.
doi: 10.1007/s00018-013-1484-0 |
42 |
KATEMALA S , MOLEE A , THUMANU K , et al. Meat quality and Raman spectroscopic characterization of Korat hybrid chicken obtained from various rearing periods[J]. Poult Sci, 2021, 100 (2): 1248- 1261.
doi: 10.1016/j.psj.2020.10.027 |
43 | LE BIHAN-DUVAL E , DEBUT M , BERRI C M , et al. Chicken meat quality: genetic variability and relationship with growth and muscle characteristics[J]. BMC Genet, 2008, 9, 53. |
44 |
WANG Y , ZHU Q , ZHAO X L , et al. Association of FATP1 gene polymorphisms with chicken carcass traits in Chinese meat-type quality chicken populations[J]. Mol Biol Rep, 2010, 37 (8): 3683- 3690.
doi: 10.1007/s11033-010-0020-7 |
[1] | Qianling CHEN, Yuzhu SHA, Xiu LIU, Pengyang SHAO, Fanxiong WANG, Xiaowei CHEN, Wenxin YANG, Zhuanhui XIE, Min GAO, Wei HUANG. Research Progress on the Interaction between Gut Microbiota and Mitochondria Regulating Animal Fat Deposition [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2293-2303. |
[2] | Ming FENG, Xudong YI, Weijun PANG. Advances in Intestinal Microorganism Regulating Pork Quality through Skeletal Muscle Fiber Type, Intramuscular Fat Content and Skeletal Muscle Metabolism [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2304-2312. |
[3] | Xiaoyi FENG, Peipei ZHANG, Hang ZHANG, Haisheng HAO, Weihua DU, Huabin ZHU, Kai CUI, Xueming ZHAO. Effects of Heat Stress on Epigenetic Modifications and Developmental Competence of Bovine Oocytes and Their Embryos [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2460-2473. |
[4] | Hang ZHANG, Peipei ZHANG, Baigao YANG, Xiaoyi FENG, Yifan NIU, Zhou YU, Jianhua CAO, Pengcheng WAN, Xueming ZHAO. Combination of IGF1, CoQ10 and MT Alleviated the Effects of Heat Stress on Bovine IVF Blastocysts [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2474-2485. |
[5] | Zhibin LUO, Huimin OU, Jianzhong LI, Zhiliang TAN, Jinzhen JIAO. Effects of Low Protein Diet Supplemented with Rumen-protected Amino Acids on Growth Performance, Nutrient Apparent Digestibility and Meat Quality of Hulun Buir Sheep [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2498-2509. |
[6] | Yalin LI, Shibo ZHEN, Lin CAO, Fengxue SUN, Lihua WANG. Effects of Lactobacillus plantarum and Lactobacillus plantarum Postbiotics on Growth Performance, Immune Status and Intestinal Health of Growing Female Minks [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2530-2539. |
[7] | Ming LI, Hongwei CUI, Jie GAO, Lele AN, Songli LI, Zhenghua RAO. Identification and Genomic Analysis of Pathogenic Escherichia coli in Small Intestinal Content of White Feather Broilers [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2692-2700. |
[8] | LIU Jiahui, WU Kaikai, WANG Lei, ZHANG Kang, HAN Songwei, CHEN Fubin, XU Guowei, GUO Zhiting, GU Xueyan, ZHANG Jingyan, LI Jianxi. Protective Effects of Astragalus Polysaccharides, Saponins and Probiotic Compounds on Intestinal Tract of Broilers Infected with E.coli [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(5): 2241-2252. |
[9] | LEI Yanru, HU Xiaoyu, XU Chunhong, ZHANG Chenxi, DU Wenping, WANG Yangguang, LI Donghua, SUN Guirong, LI Wenting, KANG Xiangtao. Comparative Analysis of Growth, Carcass and Meat Quality Traits of Five Hybrid Combinations of Houdan Chicken [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(4): 1521-1535. |
[10] | WANG Xiao, ZHANG Hao, LUAN Qingjiang, LI Hui, YANG Ding, WANG Tingyue, TIAN Jing, ZHAO Meng, CHEN Lu, TIAN Rugang. A Comprehensive Review of the Impact of Cold and Heat Stress on the Physiological Parameters and Gene Expression in Beef Cattle [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(3): 894-904. |
[11] | LI Tie, QI Mengdi, ZHANG Keying, WANG Jianping, BAI Shiping, ZENG Qiufeng, PENG Huanwei, XUAN Yue, LÜ Li, DING Xuemei. Effects of Dietary Probiotics Supplementation during Brood-rearing Period on Growth Performance, Serum Biochemistry, Intestinal Health and Subsequent Performance of Laying Hens [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(3): 1062-1076. |
[12] | ZUO Zizhen, WANG Haibo, CHAI Zhixin, FU Jianhui, ZHANG Xiangfei, LUO Xiaolin, ZHONG Jincheng. Effects of Rumen-protected Methionine on Meat Quality, Volatile Flavor Compounds and Fatty Acid Composition of Yak Semitendinosus [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(3): 1102-1114. |
[13] | LIANG Canxin, ZHENG Xiaoxue, SHU Xueli, ZHOU Wanyi, LIAO Ming, CAO Weisheng. Isolation of ALV-K Associated with Endothelial Hemangioma in Chicken and Analysis of gp85 Gene Evolution [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(3): 1127-1136. |
[14] | ZHENG Lin, WEI Bingdong, HUA Feng, CHEN Long, DING Yuan. Therapeutic Effect of Lytic Phage on Salmonella enteritidis Infection in Broilers [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(3): 1314-1327. |
[15] | HUO Yuannan, QIU Meijia, ZHANG Jiaojiao, YANG Weirong, WANG Xianzhong. Arginine and Its Metabolites Attenuate Heat Stress-induced Apoptosis of Immature Boar Sertoli Cells [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(2): 587-597. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||