INTS11通过介导CDK2和CYCLIND1的转录促进牛成肌细胞增殖

doi:10.11843/j.issn.0366-6964.2024.07.013

Abstract

Abstract:

The study aimed to verify the functional role of bovine INTS11 gene in myogenic cells, explore the sequence of the CDS region of INTS11 and the characteristics of its encoded protein by bioinformatics analysis, and verify its role in the proliferation process of bovine myogenic cells using different molecular test techniques. The bovine INTS11 gene sequence was compared with other species. This involved the construction of a phylogenetic tree and the examination of the physicochemical properties, functional structure, and subcellular localization of the encoded protein. The test material comprised 3-month-old healthy fetal bovine myoblasts isolated and cultured in vitro. The sequences of the coding sequence (CDS) region of INTS11 in myoblasts were cloned. An overexpression vector of INTS11 was constructed, and interfering sequences of the gene were designed. This was done in order to investigate its effect on the proliferation of myoblasts by CCK8, Edu, RT-qPCR and other techniques. Bioinformatic analysis showed that INTS11 had a CDS region of 1 800 bp, two functional domains (MBL-foldmetallo-hydro and β-CASP motif), which belonged to the non-transmembrane proteins and the cellular localization was mainly distributed in the cytoplasm. Transfection of pcDNA3.1-INTS11 plasmid showed that the proliferation rate of myoblasts in the test group was significantly increased compared with that in the control group at 72-96 h (P<0.05); Edu assay revealed a significant increase in the number of positive cells (P<0.05); and the RT-qPCR results showed that the mRNA expression levels of proliferation marker factors CDK2 and CYCLIND1 were significantly increased (P<0.05) compared with that in the control group. After transferring the interference sequence, the cell proliferation rate was significantly decreased (P<0.05), while the mRNA expression levels of proliferation marker factors CDK2 and CYCLIND1 were significantly decreased (P<0.05) compared with the control group. In this study, the conservation of INTS11 was predicted in the domesticated animals, and that INTS11 protein has two functional structural domains, and it promotes the proliferation of bovine myoblasts by mediating the transcription of CDK2 and CYCLIND1. This research has perfected the gene network regulating skeletal muscle growth, provided theoretical support for further exploration of the regulating mechanisms of skeletal muscle growth in the post-sequence.

Key words: INTS11, myoblast, cell proliferation, overexpression, interference

CLC Number:

S823.2

Ziyan WANG, Yahui WANG, Tianyi WU, Chen GAO, Zhenwei DU, Fei GE, Xiaobei ZHANG, Wenxuan ZHAO, Lupei ZHANG, Huijiang GAO, Huansheng DONG, Junya LI. INTS11 Promotes the Proliferation of Bovine Myoblasts by Mediating the Transcription of CDK2 and CYCLIND1[J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(7): 2927-2939.

Figures/Tables 14

Table 1

Table 2

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Fig. 6

Table 3

Fig. 7

Fig. 8

Fig. 9

Fig. 10

Fig. 11

References 41

1	ZHAO T T , ZHAO R , YI X D , et al. METTL3 promotes proliferation and myogenic differentiation through m⁶A RNA methylation/YTHDF1/2 signaling axis in myoblasts[J]. Life Sci, 2022, 298, 120496. doi: 10.1016/j.lfs.2022.120496
2	HOH J A Y . Developmental, physiologic and phylogenetic perspectives on the expression and regulation of myosin heavy chains in mammalian skeletal muscles[J]. J Comp Physiol B, 2023, 193 (4): 355- 382. doi: 10.1007/s00360-023-01499-0
3	MENG Q W , LI J W , WANG C S , et al. Biological function of resveratrol and its application in animal production: a review[J]. J Anim Sci Biotechnol, 2023, 14 (1): 25. doi: 10.1186/s40104-022-00822-z
4	SONG C C , YANG Z X , DONG D , et al. miR-483 inhibits bovine myoblast cell proliferation and differentiation via IGF1/PI3K/AKT signal pathway[J]. J Cell Physiol, 2019, 234 (6): 9839- 9848. doi: 10.1002/jcp.27672
5	CHEN M J , WEI X F , SONG M M , et al. Circular RNA circMYBPC1 promotes skeletal muscle differentiation by targeting MyHC[J]. Mol Ther Nucleic Acids, 2021, 24, 352- 368. doi: 10.1016/j.omtn.2021.03.004
6	LUO W , LIN Z T , CHEN J H , et al. TMEM182 interacts with integrin beta 1 and regulates myoblast differentiation and muscle regeneration[J]. J Cachexia Sarcopenia Muscle, 2021, 12 (6): 1704- 1723. doi: 10.1002/jcsm.12767
7	MO M J , ZHANG Z H , WANG X T , et al. Molecular mechanisms underlying the impact of muscle fiber types on meat quality in livestock and poultry[J]. Front Vet Sci, 2023, 10, 1284551. doi: 10.3389/fvets.2023.1284551
8	KONG D L , HE M , YANG L , et al. MiR-17 and miR-19 cooperatively promote skeletal muscle cell differentiation[J]. Cell Mol Life Sci, 2019, 76 (24): 5041- 5054. doi: 10.1007/s00018-019-03165-7
9	DU L L , DUAN X H , AN B X , et al. Genome-wide association study based on random regression model reveals candidate genes associated with longitudinal data in Chinese simmental beef cattle[J]. Animals (Basel), 2021, 11 (9): 2524.
10	KUANG H Z , LI Y L , WANG Y X , et al. A homozygous variant in INTS11 links mitosis and neurogenesis defects to a severe neurodevelopmental disorder[J]. Cell Rep, 2023, 42 (12): 113445. doi: 10.1016/j.celrep.2023.113445
11	FONGANG B , WADOP Y N , ZHU Y J , et al. Coevolution combined with molecular dynamics simulations provides structural and mechanistic insights into the interactions between the integrator complex subunits[J]. Comput Struct Biotechnol J, 2023, 21, 5686- 5697. doi: 10.1016/j.csbj.2023.11.022
12	DOKANEHEIFARD S , GOMES DOS SANTOS H , VALENCIA M G , et al. BRAT1 associates with INTS11/INTS9 heterodimer to regulate key neurodevelopmental genes[J]. bioRxiv, 2023, 8 (10): 552743.
13	NIU Q H , ZHANG T L , XU L , et al. Integration of selection signatures and multi-trait GWAS reveals polygenic genetic architecture of carcass traits in beef cattle[J]. Genomics, 2021, 113 (5): 3325- 3336. doi: 10.1016/j.ygeno.2021.07.025
14	LIU L , YIN L Q , YUAN Y H , et al. Developmental characteristics of skeletal muscle during the embryonic stage in Chinese Yellow Quail (Coturnix japonica)[J]. Animals (Basel), 2023, 13 (14): 2317.
15	SKAAR J R , FERRIS A L , WU X L , et al. The integrator complex controls the termination of transcription at diverse classes of gene targets[J]. Cell Res, 2015, 25 (3): 288- 305. doi: 10.1038/cr.2015.19
16	LAI F , GARDINI A , ZHANG A D , et al. Integrator mediates the biogenesis of enhancer RNAs[J]. Nature, 2015, 525 (7569): 399- 403. doi: 10.1038/nature14906
17	ALBRECHT T R , SHEVTSOV S P , WU Y X , et al. Integrator subunit 4 is a 'symplekin-like' scaffold that associates with INTS9/11 to form the Integrator cleavage module[J]. Nucleic Acids Res, 2018, 46 (8): 4241- 4255. doi: 10.1093/nar/gky100
18	HUANG H F , LIU J Z , YAO F , et al. The integrator complex subunit 11 is involved in the post-diapaused embryonic development and stress response of Artemia sinica[J]. Gene, 2020, 741, 144548. doi: 10.1016/j.gene.2020.144548
19	TEPE B , MACKE E L , NICETA M , et al. Bi-allelic variants in INTS11 are associated with a complex neurological disorder[J]. Am J Hum Genet, 2023, 110 (5): 774- 789. doi: 10.1016/j.ajhg.2023.03.012
20	HE L F , MA H H , SONG W H , et al. Arabidopsis COPT1 copper transporter uses a single histidine to regulate transport activity and protein stability[J]. Int J Biol Macromol, 2023, 241, 124404. doi: 10.1016/j.ijbiomac.2023.124404
21	YOSAATMADJA Y , BADDOCK H T , NEWMAN J A , et al. Structural and mechanistic insights into the Artemis endonuclease and strategies for its inhibition[J]. Nucleic Acids Res, 2021, 49 (6): 9310- 9326.
22	GONZÁLEZ L J , BAHR G , GONZÁLEZ M M , et al. In-cell kinetic stability is an essential trait in metallo-β-lactamase evolution[J]. Nat Chem Biol, 2023, 19 (9): 1116- 1126. doi: 10.1038/s41589-023-01319-0
23	WU Y X , ALBRECHT T R , BAILLAT D , et al. Molecular basis for the interaction between Integrator subunits IntS9 and IntS11 and its functional importance[J]. Proc Natl Acad Sci U S A, 2017, 114 (17): 4394- 4399. doi: 10.1073/pnas.1616605114
24	OSANA S , KITAJIMA Y , SUZUKI N , et al. Puromycin-sensitive aminopeptidase is required for C2C12 myoblast proliferation and differentiation[J]. J Cell Physiol, 2021, 236 (7): 5293- 5305. doi: 10.1002/jcp.30237
25	SUN C S , KANNAN S , CHOI I Y , et al. Human pluripotent stem cell-derived myogenic progenitors undergo maturation to quiescent satellite cells upon engraftment[J]. Cell Stem Cell, 2022, 29 (4): 610- 619. doi: 10.1016/j.stem.2022.03.004
26	DASILVA L F , BLUMENTHAL E , BECKEDORFF F , et al. Integrator enforces the fidelity of transcriptional termination at protein-coding genes[J]. Sci Adv, 2021, 7 (45): eabe3393. doi: 10.1126/sciadv.abe3393
27	SHI L , SONG L , MAURER K , et al. IL-1 Transcriptional Responses to Lipopolysaccharides Are Regulated by a Complex of RNA Binding Proteins[J]. The Journal of Immunology, 2020, 204 (5): 1334- 1344. doi: 10.4049/jimmunol.1900650
28	ALBRECHT T R , WAGNER E J . snRNA 3' end formation requires heterodimeric association of integrator subunits[J]. Mol Cell Biol, 2012, 32 (6): 1112- 1123. doi: 10.1128/MCB.06511-11
29	WELSH S A , GARDINI A . Genomic regulation of transcription and RNA processing by the multitasking Integrator complex[J]. Nature Reviews Molecular Cell Biology, 2023, 24 (3): 204- 220. doi: 10.1038/s41580-022-00534-2
30	CIHLAROVA Z , KUBOVCIAK J , SOBOL M , et al. BRAT1 links Integrator and defective RNA processing with neurodegeneration[J]. Nat Commun, 2022, 13 (1): 5026. doi: 10.1038/s41467-022-32763-6
31	HUANG J , LIU X Y , SUN Y D , et al. An examination of the metal ion content in the active sites of human endonucleases CPSF73 and INTS11[J]. J Biol Chem, 2023, 299 (4): 103047. doi: 10.1016/j.jbc.2023.103047
32	ZHANG P , SUI P , CHEN S , et al. INTS11 regulates hematopoiesis by promoting PRC2 function[J]. Science Advances, 2021, 7 (36): eabh1684. doi: 10.1126/sciadv.abh1684
33	DUMAN E T , SITTE M , CONRADS K , et al. A single-cell strategy for the identification of intronic variants related to mis-splicing in pancreatic cancer[J]. bioRxiv, 2023, 5 (8): 539836.
34	SHERSHER E , LAHIRY M , ALVAREZ-TROTTA A , et al. NACK and INTEGRATOR act coordinately to activate notch-mediated transcription in tumorigenesis[J]. Cell Commun, 2021, 19 (1): 96.
35	SIMON M , MIKEC S , MORTON N M , et al. Genome-wide screening for genetic variants in polyadenylation signal (PAS) sites in mouse selection lines for fatness and leanness[J]. Mamm Genome, 2023, 34 (1): 12- 31. doi: 10.1007/s00335-022-09967-8
36	ZHANG P , SUI P P , CHEN S , et al. INTS11 regulates hematopoiesis by promoting PRC2 function[J]. Sci Adv, 2021, 7 (36): eabh1684. doi: 10.1126/sciadv.abh1684
37	KALDIS P , ALEEM E . Cell cycle sibling rivalry: Cdc2 versus Cdk2[J]. Cell Cycle, 2005, 4 (11): 1491- 1494. doi: 10.4161/cc.4.11.2124
38	HE S Y , CHEN M , LIN X L , et al. Triptolide inhibits PDGF-induced proliferation of ASMCs through G0/G1 cell cycle arrest and suppression of the AKT/NF-κB/cyclinD1 signaling pathway[J]. Eur J Pharmacol, 2020, 867, 172811. doi: 10.1016/j.ejphar.2019.172811
39	WANG H , ZHANG Q , WANG B B , et al. miR-22 regulates C2C12 myoblast proliferation and differentiation by targeting TGFBR1[J]. Eur J Cell Biol, 2018, 97 (4): 257- 268. doi: 10.1016/j.ejcb.2018.03.006
40	ZHOU H Y , WANG Y C , WANG T , et al. CCNA2 and NEK2 regulate glioblastoma progression by targeting the cell cycle[J]. Oncol Lett, 2024, 27 (5): 206. doi: 10.3892/ol.2024.14339
41	BROWN V E , MOORE S L , CHEN M , et al. CDK2 regulates collapsed replication fork repair in CCNE1-amplified ovarian cancer cells via homologous recombination[J]. NAR Cancer, 2023, 5 (3): zcad039. doi: 10.1093/narcan/zcad039

基因Gene	上游引物(5′→3′) Forward primer sequence	下游引物(5′→3′) Reverse primer sequence
INTS11	AGGATGCCCGAGATCAGGGT	TGTTCTCTACACAGATGAGCGATG
INTS11-m	ccaagctggctagttaagcttATGCCCGAGATCAGGGTCA	agtggatccgagctcggtaccTCAGCTGGCCTGGGGCA

基因Gene	上游引物(5′→3′) Forward primer sequence	下游引物(5′→3′) Reverse primer sequence
INTS11	AGATCAGGGTCACGCCCTT	GCAGTCCAGAAAGTCGGTCA
CDK2	TCTTTGCTGAGATGGTGACCC	TAACTCCTGGCCAAACCACC
CYCLIND1	GACGAGCTGCTGCACATGGA	TGCTTGTTCTCCTCGGCCAC
GAPDH	CGAGCTGCTGCACATG	GGCGACGATGTCCACTTTG

SOPMA	数量 Number	百分比/% Percentage
α-螺旋Alpha helix(Hh)	219	36.56
延伸链Extended strand(Ee)	121	20.20
β-转角Beta turn(Tt)	33	5.51
无规则卷曲Random coil(Cc)	226	37.73

[1]	Binghong XIE, Yifan LIU, Fuguang XUE, Yanju SHAN, Yunjie TU, Gaige JI, Xiaojun JU, Jingting SHU, Hongxiang WU. The Mechanism of Effect of Hypoxia on Myofiber Type Transformation in Chicken Myoblasts [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2397-2408.
[2]	Chang LIU, Kexing HAO, Yan CHEN, Weibin ZENG, Hengbin YU, Lei CHEN, Jing WANG, Guangdong HU. Effects of Interference with PPARγ Gene on Proliferation, Apoptosis, Migration and Lipid Accumulation of Trophoblast Cells in Sheep [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2421-2430.
[3]	LI Qiuyun, TIAN Xinyuan, LIAO Wensheng, ZHANG Huanrong, REN Yupeng, YANG Falong, ZHU Jiangjiang, XIANG Hua. Effects of SOCS2 on Proliferation, Cycle and Apoptosis of Turbinate Bone Cells in Goats [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(5): 2226-2240.
[4]	MIAO Shu, AN Jishan, WANG Zuo, XIAO Dingfu, LAN Xinyi, LIU Lei, SHEN Weijun, WAN Fachun. Leucine Promotes the Proliferation of Bovine Myoblasts through PI3K-AKT Signaling Pathway [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(1): 142-152.
[5]	TANG Yinmei, LI Qi, LI Haiyang, LIN Yaqiu, WANG Yong, XIANG Hua, HUANG Lian, ZHU Jiangjiang. Cloning of the Goat FATP2 Gene and Its Regulatory Effect on Lipid Deposition in Precursor Adipocytes [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(9): 3642-3652.
[6]	SHAO Peng, TANG Yinmei, LIN Yaqiu, WANG Yong, XIANG Hua, HUANG Lian, ZHU Jiangjiang. Regulation Effect of PSMD9 on Lipid Deposition in Goat Precursor Adipocytes [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(9): 3653-3663.
[7]	LIANG Rui, FAN Xiaorui, ZHANG Jinqiang, PANG Quanhai. Effects of Mouse Melanocyte Silencing and Overexpression of Pigment Epithelium-Derived Factor on Melanin Synthesis [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(9): 3916-3930.
[8]	ZHANG Wanfeng, ZHAO Tianzhi, LI Jiao, YOU Ziwei, YANG Yang, CAI Chunbo, GAO Pengfei, CAO Guoqing, GUO Xiaohong, LI Bugao. Study on NR2F2 Gene Regulating Proliferation and Apoptosis of Porcine PK15 Cells [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(8): 3242-3251.
[9]	WANG Wanjie, CHEN Nanzhu, ZOU Huiying, ZHOU Xinyi, HAO Haisheng, PANG Yunwei, ZHU Huabin, ZHAO Xueming, YU Dawei, DU Weihua. Effects of Histone Methyltransferase ASH1L Overexpression on Proliferation and Apoptosis of Bovine Cumulus Cells [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(8): 3358-3368.
[10]	ZHANG Peng, WANG Mingxiu, JING Kemin, PENG Wei, TIAN Yuan, LI Yuqian, FU Changqi, SHU Shi, ZHONG Jincheng, CAI Xin. Abnormal Expression of FGFs/FGFRs and Their Mediated Signaling Pathway Genes Affect the Proliferative Activity of Undifferentiated Spermatogonia in Cattleyak [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(7): 2886-2897.
[11]	XU Tiantian, ZHANG Tongtong, WANG Meng, WANG Xin. Transcription Factor Foxq1 Affects the Proliferation of Hair Follicle Stem Cells in Cashmere Goats via WNT/β-catenin Signaling Pathway [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(6): 2653-2661.
[12]	QUBI Wuqie, LI Yanyan, LI Xin, WANG Yong, WANG Youli, LIU Wei, ZHU Jiangjiang, LIN Yaqiu. APOA4 Gene Inhibits Intramuscular Adipocyte Differentiation in Goat [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(5): 1927-1938.
[13]	BO Luqi, WANG Xueying, HOU Jiaming, ZHANG Li, ZHANG Jianhui, RUAN Rulin, ZHANG Bohan, WANG Shuang, SONG Mingxin, ZHANG Ziqun. Interference of Ts-ODC Gene of Trichinella spiralis by siRNA-757 Effect on Its Acid Resistance [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(5): 2114-2125.
[14]	WANG Kaiming, YU Zonggang, XU Xueli, AI Nini, LI Xintong, HE Jun, TAO Deng, ZHANG Shuo, MA Haiming, ZHANG Yuebo. Effect of Interfering Mtmr3 on C2C12 Cells Proliferation and Differentiation [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(4): 1478-1489.
[15]	DAN Yixin, YANG Lu, XIANG Hua, ZHANG Huanrong, REN Yupeng, YANG Falong, HE Honghong, ZHU Jiangjiang. Effects of BIRC5 on the Cycle and Apoptosis of Goat Testis Cells [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(4): 1511-1524.

INTS11 Promotes the Proliferation of Bovine Myoblasts by Mediating the Transcription of CDK2 and CYCLIND1

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 14

References 41

Related Articles 15

Recommended Articles

Metrics

Comments