连翘脂苷A通过调控TLR3-NF-κB信号通路抑制H9N2亚型禽流感病毒复制

doi:10.11843/j.issn.0366-6964.2025.10.045

Abstract

Abstract:

This study aimed to investigate the inhibitory effects of Forsythiaside A (FTA) on the replication of H9N2 avian influenza virus (H9N2 AIV) in pulmonary microvascular endothelial cells (PMVECs) and explore its underlying mechanisms. PMVECs infected with H9N2 AIV were treated with varying concentrations of FTA. Cytotoxicity was assessed using the MTT assay, and viral replication was analyzed via RT-qPCR. Protein expression levels of TLR3, TRIF, and NF-κB were evaluated using Western blot, while cytokine secretion (TNF-α, IL-6) and type Ⅰ interferons (IFN-α, IFN-β) were measured through ELISA. The results showed that FTA significantly inhibited the replication of H9N2 AIV (P < 0.05) in a dose-dependent manner. It downregulated the overexpression of TLR3, TRIF, and NF-κB proteins (P < 0.05), suppressed the secretion of pro-inflammatory cytokines (P < 0.05), and enhanced the production of type Ⅰ interferons (P < 0.05). FTA exhibits significant antiviral activity against H9N2 AIV by modulating the TLR3-NF-κB signaling pathway and regulating cytokine expression, highlighting its potential as a novel host-targeted antiviral agent.

Key words: forsythiaside A, H9N2 avian influenza virus, TLR3-NF-κB signaling pathway, cytokines, pulmonary microvascular endothelial cells, antiviral therapy, traditional Chinese medicine

CLC Number:

S853.74

ZHANG Taiming, LI Yaxuan, WANG Changshou, HU Ge. Forsythiaside A Inhibits Replication of H9N2 Avian Influenza Virus by Modulating the TLR3-NF-κB Signaling Pathway[J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(10): 5266-5276.

Figures/Tables 5

Table 1

Fig. 1

Fig. 2

Fig. 3

Fig. 4

References 36

1	CARGNIN FACCINF,PEREZD R.Pandemic preparedness through vaccine development for avian influenza viruses[J].Hum Vaccin Immunother,2024,20(1):2347019. doi: 10.1080/21645515.2024.2347019
2	XUH,ZHUS,GOVINDENR,et al.Multiple vaccines and strategies for pandemic preparedness of avian influenza virus[J].Viruses,2023,15(8):1694. doi: 10.3390/v15081694
3	XUEY,CAIX,WANGY,et al.Utilizing network pharmacology and experimental validation to i-nvestigate the underlying mechanism of Denglao Qingguan decoction against HCoV-229E[J].Heliyon,2024,10(6):e27829. doi: 10.1016/j.heliyon.2024.e27829
4	KHAZEEI TABARIM A,IRANPANAHA,BAHRAMSOLTANIR,et al.Flavonoids as promising antiviral agents against SARS-CoV-2 infection: A mechanistic review[J].Molecules,2021,26(13):3900. doi: 10.3390/molecules26133900
5	FUZIMOTOA D,ISIDOROC.The antiviral and coronavirus-host protein pathways inhibiting properties of herbs and natural compounds-Additional weapons in the fight against the COVID-19 pandemic[J].J Tradit Complement Med,2020,10(4):405-419. doi: 10.1016/j.jtcme.2020.05.003
6	LIR,HANQ,LIX,et al.Natural product-derived phytochemicals for influenza A virus (H1N1) prevention and treatment[J].Molecules,2024,29(10):2371. doi: 10.3390/molecules29102371
7	KUMARA D,SHAMIMM G,JAMALS U.A systemic review on medicinal plants and their bioactive constituents against avian influenza and further confirmation through in-silico analysis[J].Heliyon,2023,9(3):e14386. doi: 10.1016/j.heliyon.2023.e14386
8	CHENZ,YES Y.Research progress on antiviral constituents in traditional Chinese medicines and their mechanisms of action[J].Pharm Biol,2022,60(1):1063-1076. doi: 10.1080/13880209.2022.2074053
9	ZHANGZ J,MORRIS-NATSCHKES L,CHENGY Y,et al.Development of anti-influenza agents from natural products[J].Med Res Rev,2020,40(6):2290-2338. doi: 10.1002/med.21707
10	YANH,MAL,WANGH,et al.Luteolin decreases the yield of influenza A virus in vitroby interfering with the coat protein I complex expression[J].J Nat Med,2019,73(3):487-496. doi: 10.1007/s11418-019-01287-7
11	KANGJ X,LIUJ,WANGJ,et al.The extract of huanglian, a medicinal herb, induces cell growth arrest and apoptosis by upregulation of interferon-beta and TNF-alpha in human breast cancer cells[J].Carcinogenesis,2005,26(11):1934-1939. doi: 10.1093/carcin/bgi154
12	LUZ B,LIUS H,OUJ Y,et al.Forsythoside A inhibits adhesion and migration of monocytes to type Ⅱ alveolar epithelial cells in lipopolysaccharide-induced acute lung injury through upregulating miR-124[J].Toxicol Appl Pharmacol,2020,407,115252. doi: 10.1016/j.taap.2020.115252
13	HUOC,JINY,ZOUS,et al.Lethal influenza A virus preferentially activates TLR3 and triggers a severe inflammatory response[J].Virus Res,2018,257102-112.
14	LAWA H,YANGC L,LAUA S,et al.Antiviral effect of forsythoside A from Forsythia suspensa (Thunb.) Vahl fruit against influenza A virus through reduction of viral M1 protein[J].J Ethnopharmacol,2017,209,236-247. doi: 10.1016/j.jep.2017.07.015
15	DENGL,PANGP,ZHENGK,et al.Forsythoside A controls influenza A virus infection and improves the prognosis by inhibiting virus replication in mice[J].Molecules,2016,21(5):524. doi: 10.3390/molecules21050524
16	NANGN T,LEEJ S,SONGB M,et al.Induction of inflammatory cytokines and Toll-like receptors in chickens infected with avian H9N2 influenza virus[J].Vet Res,2011,42(1):64. doi: 10.1186/1297-9716-42-64
17	ZHIY,ZHAOX,LIUZ,et al.Oxymatrine modulation of TLR3 signaling: A dual-action mechanism for H9N2 avian influenza virus defense and immune regulation[J].Molecules,2024,29(9):1945. doi: 10.3390/molecules29091945
18	RAMAKRISHNANM A.Determination of 50% endpoint titer using a simple formula[J].World J Virol,2016,5(2):85-86. doi: 10.5501/wjv.v5.i2.85
19	TOLOSA L, DONATO M T, GÓMEZ-LECHÓN M J. General cytotoxicity assessment by means of the MTT assay[M]//VINKEN M, ROGIERS V. Protocols in in vitro hepatocyte research. New York: Humana Press, Springer, 2015: 333-348.
20	MENGS,XIAF,XUJ,et al.Hepatocyte growth factor protects pulmonary endothelial barrier against oxidative stress and mitochondria-dependent apoptosis[J].Chin Med J,2022,135(7):837-848. doi: 10.1097/CM9.0000000000001916
21	SUNJ,ZHUJ,CHENL,et al.Forsythiaside B inhibits myocardial fibrosis via down regulating TGF-β1/Smad signaling pathway[J].Eur J Pharmacol,2021,908,174354. doi: 10.1016/j.ejphar.2021.174354
22	PANC W,ZHOUG Y,CHENW L,et al.Protective effect of forsythiaside A on lipopolysaccharide/d-galactosamine-induced liver injury[J].Int Immunopharmacol,2015,26(1):80-85. doi: 10.1016/j.intimp.2015.03.009
23	ZHIY,WEIJ,LIUZ,et al.Inhibitory effects of Belamcanda extract on inflammatory response and antiviral mechanism in H9N2 Avian influenza virus: insights from in vitroand in vivo studies[J].Poult Sci,2024,103(8):103885. doi: 10.1016/j.psj.2024.103885
24	GAOG,HEC,WANGH,et al.Polysaccharide nanoparticles from Isatis indigotica Fort. root decoction: Diversity, cytotoxicity, and antiviral activity[J].Nanomaterials (Basel),2021,12(1):30. doi: 10.3390/nano12010030
25	SA-NGIAMSUNTORNK,SUKSATUA,PEWKLIANGY,et al.Anti-SARS-CoV-2 activity of Andrographis paniculataextract and its major component andrographolide in human lung epithelial cells and cytotoxicity evaluation in major organ cell representatives[J].J Nat Prod,2021,84(4):1261-1270. doi: 10.1021/acs.jnatprod.0c01324
26	LIZ,LIL,ZHOUH,et al.Radix isatidispolysaccharides inhibit influenza A virus and influenza A virus-induced inflammation via suppression of host TLR3 signaling in vitro[J].Molecules,2017,22(1):116. doi: 10.3390/molecules22010116
27	CHENJ X,XUEH J,YEW C,et al.Activity of andrographolide and its derivatives against influenza virusin vivo and in vitro[J].Biol Pharm Bull,2009,32(8):1385-1391. doi: 10.1248/bpb.32.1385
28	MAQ,LIR,PANW,et al.Phillyrin (KD-1) exerts anti-viral and anti-inflammatory activities against novel coronavirus (SARS-CoV-2) and human coronavirus 229E (HCoV-229E) by suppressing the nuclear factor kappa B (NF-κB) signaling pathway[J].Phytomedicine,2020,78,153296. doi: 10.1016/j.phymed.2020.153296
29	WANGX,LIX,WANGX,et al.Experimental study of Forsythoside A on prevention and treatment of avian infectious bronchitis[J].Res Vet Sci,2020,135,523-531.
30	SILVESTRINIA,GIORDANIC,BONACCIS,et al.Anti-inflammatory effects of olive leaf extract and its bioactive compounds oleacin and oleuropein-aglycone on senescent endothelial and small airway epithelial cells[J].Antioxidants (Basel),2023,12(8):1509. doi: 10.3390/antiox12081509
31	ZHANGL,YEX,LIUY,et al.Research progress on the effect of traditional Chinese medicine on the activation of PRRs-mediated NF-κB signaling pathway to inhibit influenza pneumonia[J].Front Pharmacol,2023,14,1132388. doi: 10.3389/fphar.2023.1132388
32	WANGY,ZHANGX,BIK,et al.Critical role of microRNAs in host and influenza A (H1N1) virus interactions[J].Life Sci,2021,277,119484. doi: 10.1016/j.lfs.2021.119484
33	LUDWIGS.Targeting cell signalling pathways to fight the flu: towards a paradigm change in anti-influenza therapy[J].J Antimicrob Chemother,2009,64(1):1-4. doi: 10.1093/jac/dkp161
34	PLESCHKAS,WOLFFT,EHRHARDTC,et al.Influenza virus propagation is impaired by inhibition of the Raf/MEK/ERK signalling cascade[J].Nat Cell Biol,2001,3(3):301-305. doi: 10.1038/35060098
35	ZHENGX,FUY,SHIS S,et al.Effect of forsythiaside A on the RLRs signaling pathway in the lungs of mice infected with the influenza A virus FM1 strain[J].Molecules,2019,24(23):4219. doi: 10.3390/molecules24234219
36	ZHENGX,CHENZ Q,SHIS S,et al.Forsythiaside A improves influenza A virus infection through TLR7 signaling pathway in the lungs of mice[J].BMC Complement Med Ther,2022,22(1):164. doi: 10.1186/s12906-022-03644-8

基因名称 Gene name	序列(5′→3′)Sequence
基因名称 Gene name	正向引物Forward primer	反向引物Reverse primer
TLR3	AGCCATTTGAAGCTGACAC	CTGCATCCAAGAGAGCAAG
TRIF	CTGTCATTTCTTGAGCGTGA	ATCCAGGTTATTGCTTCTGTG
NF-κB	CCCCTGAGAAAGAAACACA	CCTGAAACCCCACATCC
GAPDH	ATGGCTACAGCAACAGGGT	TTATGGGGTCTGGGATGG

[1]	LIU Yuze, YU Zhuoya, GONG Zhiguo, REN Peipei, ZHAO Jiamin, MAO Wei, ZHANG Shuangyi, FENG Shuang. The Impact of Lipoprotein on the Secretion of Inflammatory Mediators and the Synthesis of Prostaglandin E2 in Bovine Bone Marrow-derived Macrophages Infected with Staphylococcus aureus [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(7): 3474-3483.
[2]	LI Wenchao, LI Weiqiao, LI Xin, WANG Jiaqing, ZHANG Yawei, LI Junping. Research Progress on Antimicrobial Resistance of Animal-derived Bacteria and Elimination of Antimicrobial Resistance by Traditional Chinese Medicine [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(6): 2555-2576.
[3]	ZHAO Ying, WANG Jinglei, WANG Meng, WANG Libin, ZHANG Qian, LI Zhijie, MA Xin, YU Sijiu, PAN Yangyang. Preparation and Characterization of Forsythiaside A and Kaempferol Encapsulated in Milk-derived Exosomes and Evaluation of Anti-inflammatory Effects in vitro [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(5): 2481-2495.
[4]	LIN Xinyi, JIANG Xinyu, SU Zinuo, WANG Yuling, RUAN Shiyu, HONG Hailong, WU Jiahao, BO Ruonan. Study on Preparation and the Mucosal Immune Adjuvant Activity of Ultra-Large Mesoporous Silica Nanoparticles Loading Polysaccharide from Atractylodes macrocephala Koidz [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(5): 2507-2519.
[5]	WU Junjie, Lü Shiming, LONG Xiaoxia, WANG Zhong, WANG Liqi. Research Progress on the Antibacterial Effects and Mechanisms of Traditional Chinese Medicine and Active Ingredients against Drug-resistant Bacteria [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(4): 1632-1647.
[6]	QIU Qian, SANG Rui, WANG Wei, LIU Xinman, YU Minghong, LIU Xiaotong, YU Tian, ZHANG Xuemei. Study on the Activity of Huning Powder against Chicken Lung-derived E. coli and the in vitro Effects of Anti-inflammation and Anti-oxidation [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(4): 1969-1980.
[7]	Yiqian FU, Dongge LIANG, Mingyang WANG, Jiajia PAN, Yanbin YANG, Lei ZENG, Xiangtao KANG. Construction of Interferon Regulatory Factor Knockdown Cell Line and Its Effect on Pseudorabies Virus Proliferation [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(9): 4100-4109.
[8]	Tingting XIAN, Yan LIU, Xin CAO, Tao FENG. Analysis of the Changes of Vaginal Microflora and Serum Pro-inflammatory Cytokines and Their Correlation in Sows with Endometritis [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(8): 3688-3698.
[9]	LI Pengxu, LI Shijing, SUN Jun, XIANG Wei, ZHAO Miaomiao, HOU Tianmu, LI Huaming, GUANG Min, CHEN Ruige, XU Mengran, WU Xiaomin, JIANG Hexiang, LEI Liancheng, ZHANG Fuxian. Molecular Subtyping and Identification of Streptococcus suis Meningitidis Type 2 and Its Biological Characteristics [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(3): 1192-1207.
[10]	LUO Chenghui, GAO Jiangrui, CHEN Junwei, WEI Chunjie, WEI Shuangshuang, PEI Yechun. Construction of Mouse Model of Dust Mite Induced Atopic Dermatitis and Asthma [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(3): 1257-1267.
[11]	ZHANG Zixuan, ZHANG Ying, LI Zhijun, YANG Jingling, JIANG Zihao, HUANG Huamin, QI Xuefeng. The Effects of Bovine Viral Diarrhoea Virus (BVDV)-induced Ferroptosis on Virus Replication [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(12): 5716-5724.
[12]	ZHANG Meiwen, WANG Chenglong, LIU Yuzhen, ZHAO Yutong, ZHU Jiping, LI Yi. Analysis of the Inhibitory Effect of Salidroside on Canine Parvovirus Replication in vitro [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(12): 5738-5750.
[13]	Kexin WANG, Xian WU, Haizhou GONG, Qiaoyu FANG, Xiangchen LI, Yanan ZHANG. Effects of Co-Treatment of Sodium Butyrate and Indole-3-Propionic Acid on Tight Junctions and Inflammatory Cytokines in Caco-2 Cells [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(11): 5124-5134.
[14]	XING Baorui, LIU Zhen, ZHAO Haiping, MA Zefang, LI Xunsheng, ZHOU Jue, SUN Hongmei. Research Progress in Reverse Osteogenesis of Deer Antler [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(6): 2231-2240.
[15]	LIU Yankun, LUO Runbo, LIN Yan, ZHU Weiyun. Effects of Phage Cocktail on Growth Performance, Blood Parameters and Fecal Microbiota of Weaned Piglets [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(4): 1555-1567.

Forsythiaside A Inhibits Replication of H9N2 Avian Influenza Virus by Modulating the TLR3-NF-κB Signaling Pathway

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 5

References 36

Related Articles 15

Recommended Articles

Metrics

Comments