Loading...

Table of Content

23 February 2021, Volume 52 Issue 2
REVIEW
Research Progress of Mitochondrial Dynamics and Oxidative Phosphorylation in Mammal
WEN Yuliang, LIU Xiu, WANG Jiqing, HU Jiang, LUO Yuzhu, LI Shaobin
2021, 52(2):  273-285.  doi:10.11843/j.issn.0366-6964.2021.02.001
Abstract ( 835 )   HTML( )   PDF (2003KB) ( 974 )  
References | Related Articles | Metrics
Mitochondria is an organelle with double layered membrane and fluidity, which is the main place for aerobic respiration of cells and provides energy for cell proliferation, migration and survival, hence it is called “power house”. Mitochondria plays an important role in biological processes such as cell death, cell senescence, autophagy, lipid synthesis, calcium homeostasis and iron balance, etc, and its function is mainly regulated by mitochondrial fusion and fission. ATP production is regulated by mitochondrial fusion related proteins such as mitofusin-1 (Mfn1), mitofusin-2 (Mfn2) and optic atrophy 1 (OPA1). Cell division and mitosis are promoted by mitochondria fission related proteins such as dynamin-related protein 1 (Drp1), fission 1 (Fis1), mitochondria fission factor (MFF) and mitochondria dynamin protein 49/51 (Mid49/51). This review discusses the molecular mechanisms of mitochondrial fusion, fission and oxidative phosphorylation, emphasizes the biological significance of mitochondrial morphology and dynamics, especially the regulation mechanism of mitochondria related genes and proteins in bodys and cells of animals, and prospects the research trends of mitochondrial dynamics and morphology in animal husbandry, which will provides a reference for mitochondrial research.
The Role of Mitochondrial DNA in Innate Immunity
SONG Yinjuan, LIAO Yi, ZHOU Xiangmei
2021, 52(2):  286-299.  doi:10.11843/j.issn.0366-6964.2021.02.002
Abstract ( 621 )   HTML( )   PDF (1565KB) ( 897 )  
References | Related Articles | Metrics
Mitochondria are important cellular organelles involved in many different functions and are known as the energy factory of cells. Mitochondria maintain their genetic material, mitochondrial DNA (mtDNA), mtDNA is widely known for its role in oxidative phosphorylation. In recent years, increasing researches show that mtDNA acts as an agonist of the innate immune system and plays an important role in the pathogen infection and the pathologic development of inflammatory diseases. On entering the cytoplasm or extracellular environment, mtDNA can engage multiple pattern-recognition receptors of the innate immune system to trigger pro-inflammatory cytokines secretion and type Ⅰ interferon response. This review summarizes the mechanism of mtDNA to activate innate immunity and its role in the pathogenesis of infection and related diseases, the purpose is to provide theoretical basis for further research on the role and mechanism of mtDNA in pathogen infection and related diseases.
Advances in Molecular Epidemiology of Giardia duodenalis from Cattle in China
CAI Weilong, LI Na, FENG Yaoyu, XIAO Lihua
2021, 52(2):  300-310.  doi:10.11843/j.issn.0366-6964.2021.02.003
Abstract ( 592 )   HTML( )   PDF (1135KB) ( 706 )  
References | Related Articles | Metrics
Giardia spp. are globally widespread, including seven species. One of the species, Giardia duodenalis, is an important intestinal parasite in humans and other mammals. It causes diarrhea, malnutrition, weight loss and other clinical manifestations. Molecular diagnostic tools have been developed for the detection, genotyping, and tracking of G. duodenalis, and the use of molecular diagnostic tools has significantly changed our understanding of the zoonotic potential of the parasite. G. duodenalis can be divided into 8 assemblages (A-H) using molecular typing tools. These assemblages differ significantly in host ranges, with assemblages A and B being identified as zoonosis. Cattle are commonly infected with G. duodenalis, but the current understanding of giardiasis is insufficient and the influence on public health has always been neglected. This article summarizes recent developments in the molecular epidemiology of G. duodenalis from cattle in China. It shows that the infections of G. duodenalis are widespread in China. In the distribution of G. duodenalis genotypes, assemblage E predominates while assemblages A and B occur sporadically. As assemblage E has recently been found in humans in several other countries and the occurrence of assemblage A in cattle has shown an increase in recent years, the zoonotic potential of G. duodenalis from cattle is gradually being recognized.
Mechanism of Ammonia Affecting Animal Health and Productive Performance
CUI Jia, YANG Xinyu, LI Nan, CHEN Baojiang
2021, 52(2):  311-321.  doi:10.11843/j.issn.0366-6964.2021.02.004
Abstract ( 770 )   HTML( )   PDF (946KB) ( 1074 )  
References | Related Articles | Metrics
The breeding environment is gradually deteriorating with the increase in the number and scale of livestock and poultry breeding. Since livestock and poultry are extremely sensitive to the air quality, the air quality is directly related to animal morbidity. Ammonia (NH3) is one of the most harmful pollution sources in animal production. If the animal continuously exposed environment of ammonia, it will induce respiratory system diseases, cause neurological dysfunction, reduce the ability of reproduction and growth. Here we summarized the mechanism by which ammonia effects animal health and production performance.
ANIMAL GENETICS AND BREEDING
Sequence Characteristics and Expression Analysis of CA5B Gene in Pigs
GUO Jin, FAN Xinhao, YANG Yalan, LIANG Guoming, TANG Zhonglin
2021, 52(2):  322-330.  doi:10.11843/j.issn.0366-6964.2021.02.005
Abstract ( 580 )   HTML( )   PDF (5368KB) ( 681 )  
References | Related Articles | Metrics
This study aimed to analyze the effects of CA5B (carbonic anhydrase 5b, mitochondria; CA5B/CAVB/Car5b) on the organ/tissue development and metabolism in pigs through investigating its sequence characteristics and spatial expression patterns. The heart, liver, spleen, lung, kidney, subcutaneous fat, longissimus dorsi, testis and ovary tissues of 3 boars and 3 sows of 240-day-old Guizhou pigs were collected, and the skeletal muscle tissues at 27 growth and development time points (33, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105 days before birth and 0, 9, 20, 30, 40, 60, 80, 100, 120, 140, 160, 180 days after birth) of 3 Tongcheng pigs and 3 Landrace pigs were also collected. We performed transcription sequencing using RNA extracted from the above tissues, and analyzed the expression profile of CA5B gene in 9 tissues and it's temporal expression in skeletal muscle at 27 development time points. Then the conservative analysis among species, construction of phylogenetic tree and protein interaction network analysis of CA5B gene were conducted based on its protein sequence extracted from NCBI database. Finally, three softwares (Targetscan, PicTar, miRanda) were used to predict the potential miRNAs binded to CA5B gene. The RNA editing sites located in CA5B gene were also detected using the RNA editing database. The results showed that CA5B gene was highly conservative expressed in pig, human, mouse, monkey, cattle, horse, goat, sheep, dog and cat, moreover, the pig and human had higher homology than mouse based on the protein sequence of CA5B. Interaction network showed that CA5B protein mainly interacted with mitochondrial transmembrane transport protein, myosin-like coiled-coil protein, cytochrome family and other proteins. The CA5B was highly expressed in fat, testis and ovary, and the expression level in embryonic period was higher than that in postnatal period in skeletal muscle. In addition, target prediction results suggested that CA5B might be regulated by ssc-miR-22-5p (P<0.05), and there were 3 RNA editing sites in CA5B. The results suggested that CA5B potentially play an important role in skeletal muscle growth, development,energy storage and utilization in pig.
Polymorphisms in the 5'Regulatory Region of PLAG1 Gene and Their Association with Early Body Weight of Hu Sheep
GUO Xiaoxiao, LI Yinxia, WANG Yue, ZHANG Han, ZHANG Jun, QIAN Yong, MENG Chunhua, WANG Huili, ZHONG Jifeng, CAO Shaoxian
2021, 52(2):  331-343.  doi:10.11843/j.issn.0366-6964.2021.02.006
Abstract ( 522 )   HTML( )   PDF (2276KB) ( 594 )  
References | Related Articles | Metrics
This experiment aimed to clone the sequence of the 5'regulatory region of Hu sheep's PLAG1 gene, analyze the relationship between its polymorphisms and the early body weight, and look for the molecular markers for assisted selection of growth traits of Hu sheep. The 5'RACE method was used to identify the transcription initiation site of PLAG1 of Hu sheep. Four hundred fifty six weaned Hu sheep were selected as research objects, the nucleotide polymorphisms in the PLAG1 5' regulatory region were screened by cloning and sequencing, SPSS 18.0 was used to analyze the influence of different genotypes on the birth weight and weaning weight of Hu sheep. The results showed that the transcription initiation site was located at g.30535 locus of the PLAG1 gene. Fifteen SNPs were identified with 3 genotypes in PLAG1 5'regulatory region of Hu sheep population, and these SNPs were in Hardy-Weinberg equilibrium. Correlation analysis showed that the birth weight of Hu sheep with AA, GG, CC and AA genotypes at g.28888A>T, g.28901G>T, g.30802C>T and g.30825A>G loci, respectively were significantly higher than those of Hu sheep with corresponding heterozygous genotypes (P<0.05), and weaning weight of Hu sheep with CC genotype at g.30737T>C locus was significantly lower than that of Hu sheep with TC genotype (P<0.05). Linkage analysis showed that g.28888A>T, g.28901G>T, g.28913T>A, g.29717G>C, g.29724A>C, g.29725G>A, g.29768T>C, g.29771A>G, g.30141T>A, G.30144A>G, g.30691C>A, g.30694A>T, g.30737T>C, g.30802C>T, g.30825A>G were closely linked and detected 18 haplotypes. Further association analysis showed that 5 haplotypes with large sample size among them were associated with early body weight, the birth weight of Hu sheep with AAGGTAGGAAGGTTAATTAACCAATCCCAA haplotype was significantly higher than that of Hu sheep with ATGTTAGCACGATCAGTAAGCAATTCCTAG haplotype (P<0.05), the its weaning weight was significantly higher than that of AAGGAAGGAAGGTTAATTAACCAACCCCAA haplotype (P<0.05). The result indicated that there were 15 linkage SNPs loci in the 5' regulatory region of PLAG1 gene in Hu sheep population; g.28888A>T, g.28901G>T, g.30802C>T, g.30825A>G loci were significantly associated with birth weight (P<0.05); g.30737T>C locus was significantly associated with weaning weight (P<0.05); AAGGTAGGAAGGTTAATTAACCAATCCCAA haplotype was significantly associated with birth weight and weaning weight (P<0.05). All these data demonstrated that PLAG1 gene could be used as a candidate genetic marker for the growth traits selection of Hu sheep.
Estimation of Genetic Parameters of Reproductive Traits of Holstein Heifers in Ningxia
CHEN Ziwei, SHI Rui, LUO Hanpeng, TIAN Jia, WEI Chen, ZHANG Weixin, LI Weiqi, WEN Wan, WANG Yajing, WANG Yachun
2021, 52(2):  344-351.  doi:10.11843/j.issn.0366-6964.2021.02.007
Abstract ( 677 )   HTML( )   PDF (716KB) ( 755 )  
References | Related Articles | Metrics
The study aimed to explore the population genetic parameters of reproductive traits of heifers and evaluate the genotype-by-environment interaction (G×E) effect for heifer fertility between different inseminate seasons. The reproductive information of Holstein cows from 12 farms in Ningxia from 2007 to 2019 was used. Totally 30 645-44 888 heifer reproductive phenotypic records were obtained, including age at first service (AFS), age at first calving (AFC), 56-days non-return rate of first insemination (NRR56), interval from first to last inseminations (IFL), gestation length (GL) and conception rate of first insemination (CR). Then, a single-trait animal model was used to obtain heritability of each trait and a bi-variate animal model was also applied to estimate genetic correlations between traits and G×E interaction degree between insemination seasons (genetic correlation of the same trait between different environments, r) with the DMUAI module of DMU. The results showed that the heritabilities and their standard error of heifer reproductive traits were: 0.483±0.013, 0.231±0.015, 0.031±0.007, 0.038±0.008, 0.216±0.017 and 0.031±0.007 for AFS, AFC, NRR56, IFL, GL and CR, respectively. IFL and GL was significantly and positively correlated with AFC (IFL-AFC: 0.812±0.019, P<0.05; GL-AFC: 0.119±0.053, P<0.05); NRR56 and CR were significantly and negatively correlated with AFC (NRR56-AFC: -0.274±0.086, P<0.05; CR-AFC: -0.532±0.065, P<0.05). Except for IFL in summer-autumn pair and CR, NRR56, IFL in autumn-winter pair (r>0.8), CR, NRR56, IFL had G×E interaction effects (r<0.8) in other season pairs. For CR, the lowest correlation coefficient was observed for insemination between spring and winter, while the genetic correlation for insemination between spring and autumn was the lowest for NRR56 and IFL. The result indicate that the growth and pregnancy maintenance ability of heifers have preferential genetic selection potential, while the conception ability of heifer is affected largely by environment. It is necessary to take climate condition differences into consideration when heifer fertility traits are genetically evaluated due to the existence of G×E, and use more suitable models to improve the accuracy of genetic selection in breeding practices.
Effects of the Number of Subclinical Mastitis Infection during First 60 Days after Calving on SCS of Lactation Months of Holstein Cows
LIANG Yan, WANG Haiyang, GUO Mengling, ZHANG Qiang, GAO Qisong, LI Mingxun, ZHANG Huimin, YANG Zhangping, MAO Yongjiang
2021, 52(2):  352-363.  doi:10.11843/j.issn.0366-6964.2021.02.008
Abstract ( 466 )   HTML( )   PDF (3214KB) ( 457 )  
References | Related Articles | Metrics
The number of subclinical mastitis (SCM) infection during first 60 days after calving reflects the physiological health of the mammary gland of Holstein cows. This study aimed to explore the effects of the number of SCM infection during first 60 days after calving on somatic cell score (SCS) of lactation months in Holstein cows, and provide scientific reference for farm management for prevention, control and treatment of SCM. A total of 365 105 DHI records of Holstein cows were collected from 12 dairy farms in Jiangsu province from 2017 to 2019, and the impacts of the number of SCM infection during first 60 days after calving on SCS of lactation months of cows with different parities, farm size, tested seasons and calving seasons were analyzed using general linear model (GLM). The results showed that the number of SCM infection in first 60 days after calving had extremely significant effects on milk SCS of lactation months of Holstein cows with different parities, farm size, tested seasons and calving seasons (P<0.01). Holstein cows with 5th and above parity or calved in summer had higher SCM incidence during first 60 days after calving. The SCS of lactation months of cows showed extremely significant increase along with the increasing number of SCM infection in first 60 days after calving in small- and medium-size farms and cows that calved in summer and autumn (P<0.01). The correlation coefficient between SCS in first 60 days after calving and SCS in each lactation month decreased gradually with the increase of lactation months. The lowest correlation coefficients between SCS in first 60 days after calving and SCS from 3rd to 7th lactation month were observed in cows of 1st parity, but higher in cows of 4th parity. Cows calved in autumn showed greater than 0.43 of correlation coefficients between SCS in first 60 days after calving and SCS from 3rd to 5th lactation month, which was higher than other seasons. The results are helpful for dairy farms to predict SCS in mid-late lactation according to the number of SCM infection during first 60 days after calving, so as to guide dairy farms to take relevant measures in time to prevent and control SCM.
Key Regulatory Factors of Intramuscular Fat Deposition in Donkey
LI Wufeng, SUN Yutong, GUAN Jiawei, ZHAO Jingwei, DU Min
2021, 52(2):  364-375.  doi:10.11843/j.issn.0366-6964.2021.02.009
Abstract ( 601 )   HTML( )   PDF (3644KB) ( 601 )  
References | Related Articles | Metrics
The aim of this study was to screen the key regulatory factors of intramuscular fat deposition in donkey based on transcriptome (RNA-Seq) and metabolome (UPLC-MS/MS) association analysis. Thirty female Guangling donkeys with the same feeding condition and average body weight of 236.10 kg were selected to detect the content of intramuscular fat (IMF) in the longi-ssimus dorsi. According to the level of IMF content, the donkeys were divided into two groups: the low-IMF group (L group, n=3) and the high-IMF group (H group, n=3), the transcriptomics and metabolomics sequencing analysis were performed. KEGG association analysis and correlation analysis of differentially expressed genes (DEGs) and differential metabolites (DAMs) were carried out, and the correlation network was constructed. The results showed that a total of 72 differential metabolites were identified between L group and H group, of which 27 metabolites were up-regulated and 45 metabolites were down-regulated. Correlation analysis showed that a total of 35 co-enriched pathways were identified between DEGs and DAMs, among them, glycerolipid metabolism, glycerophospholipid metabolism, arachidonic acid metabolism, linoleic acid metabolism and biosynthesis of unsaturated fatty acids pathways were associated with the IMF deposition. A total of 8 DEGs and 15 DAMs were enriched in the 5 pathways, including DGKA, DGAT2, PLA2G3, GPCPD1 and SCD, as well as the DAMs such as glycerol-3-phosphate(G3P), lysophosphatidic acid(LPA), lysophosphatidylcholine(LPC), docosahexaenoic acid(DHA) and arachidonic acid(AA). In addition, the DGAT2, PLA2G3, GPCPD1 and DGKA genes in the glycerolipid metabolism and glycerophospholipid metabolism pathways were found to be highly correlated with their corresponding metabolites by network map analysis. DEGs identified in this study might be potential candidate genes related to IMF deposition, which would provide a theoretical basis for further research on the molecular regulation mechanism of IMF deposition and molecular breeding for meat quality of donkey.
A Comparative Study on Chromosome-level Genomes of Sika Deer and Red Deer
TANG Lixin, WANG Tianjiao, LIU Huamiao, ZHANG Ranran, XING Xiumei
2021, 52(2):  376-388.  doi:10.11843/j.issn.0366-6964.2021.02.010
Abstract ( 706 )   HTML( )   PDF (4597KB) ( 649 )  
References | Related Articles | Metrics
The purpose of this study was to reveal the origin and evolution of sika deer and red deer at the genome level, to find the signal pathways related to the evolution process and to explore their correlation with the phenotypes. The chromosome-level genomes of adult female sika deer and adult male red deer were used as research objects and the comparative genomics was used to perform the analysis of chromosome collinearity. The homologous relationship of genomic sequences and the phenomenon of chromosome inversion between the two species were obtained. The functional enrichment analysis of GO and KEGG were carried out for the two kinds of genes which were truncated by inversion and untruncated inside the inversion, respectively. At the same time, the collinearity analysis of genes on chromosomes of the two species were performed to identify the orthologous regions between the two genomes, detect the orthologous genes and estimate the divergence time of two species. The results showed the homology between the genomes of sika deer and red deer, and 27 chromosomes had a homology of more than 95%. We also identified sika deer chromosome 23 as the X chromosome by the alignment. By statistical analysis of chromosomal inversion and functional enrichment of genes involved in the inversions by GO and KEGG, there were 37 847 inversions in sika deer genome and the number of inverted fragments in 1-5 kb was the largest. The biological processes and molecular functions of GO functional enrichment of genes involved in inversion included detection of chemical stimulus involved in sensory perception of smell, sensory perception of smell, olfactory receptor activity, signal transducer activity. The signal pathway of KEGG enrichment was olfactory transduction. A total of 79 homologous regions and 12 629 orthologous genes were detected by collinearity analysis, and the divergence time between sika deer and red deer was estimated to be 0.318 MYA by using the synonymous mutation rate (Ks). In this study, the comparative genomic was used to find the homology relationship between sika deer and red deer genomes, and the phenomenon of chromosome inversion in two species were obtained. Through functional enrichment analysis, it was found that chromosome inversion was related to olfactory phenotype, which provided a new theoretical basis for the study of chromosome evolution in Cervus.
ANIMAL BIOTECHNOLOGY AND REPRODUCTION
Observation of Ovary Histology and Ultrastructure of Follicles in Tibetan Sheep
GUO Yajun, LIU Miaomiao, FU Dehai, RAN Xingrong, WANG Xinrong
2021, 52(2):  389-398.  doi:10.11843/j.issn.0366-6964.2021.02.011
Abstract ( 570 )   HTML( )   PDF (6899KB) ( 861 )  
References | Related Articles | Metrics
The study aimed to observe the histological features of Tibetan sheep's follicles and corpus luteum and follicle ultrastructure, and explore the relationship between them and their physiological functions. The tissue structure characteristics of the ovarian follicles and corpus luteum of Tibetan sheep and the ultramicroscopic morphology of the follicles were examined and analyzed using gross dissection, traditional tissue sectioning, H.E staining and transmission electron microscopy. The results showed that the width and thickness of the ovaries between Tibetan sheep's luteal phase and follicular phase were significantly different (P<0.05), but there were no significant difference in weight and length (P>0.05). Most of the ovarian follicles shrunk through granular cells atresia and fibrosis; theca corpus luteum cells (the diameter 22 μm) and granular corpus luteum cells (the diameter 50 μm) in the corpus luteum had apparent structural characteristics and clear boundaries, there was abundant capillaries in corpus luteum; through observing the follicle's ultrastructure, it was found that as the follicle developing, its form changed from an ellipse to a polygon, the number increased and the follicle was surrounded by membranous cells, the amount and types of organelles also increased; the organelles were closely connected, and the cytoplasm contained secreted cortical granules. The results showed that the histological characteristics of follicular system and corpus luteum of Tibetan sheep were similar to those of other sheep and goat breeds, with the development of follicles, the proliferation of blood vessels was faster, the changes of follicular structure and the densification of organelles increased, and the follicles could be shrunk at different stages; the structure of the two luteal cells was more complete and characterized by capillary breeding, which may be an important basic guarantee for Tibetan sheep to play ovarian function under high altitude hypoxia.
The Establishment of X, Y Sperm Sorting System in Yak by Flow Cytometer
XIONG Xianrong, ZHANG Yan, XIONG Yan, MIN Xingyu, WU Jinbo, HAO Zhenyu, ZHANG He, LI Jian
2021, 52(2):  399-407.  doi:10.11843/j.issn.0366-6964.2021.02.012
Abstract ( 634 )   HTML( )   PDF (1818KB) ( 551 )  
References | Related Articles | Metrics
The main objective of this study was to optimize the technical conditions of yak (Bos grunniens) sperm sorting and establish an efficient yak X, Y sperm sorting technology system. Yak semen suspension was prepared, and sperm cells were incubated with different amounts of DNA dye Hoechst33342 and Allura Red. Yak X and Y sperms were separated by flow cytometer, and the sorting conditions were optimized by comparing sorting efficiency, sorted sperm motility and developmental potential. Furthermore, the purity of sorted sperm was detected by single sperm RT-PCR, and the motility of sorted sperm was detected by sperm analysis system. Then, the sorted sperm were fertilized in vitro with matured oocytes. The developmental potential of the sorted sperm was evaluated, and the sex of early embryo was detected by PCR of SRY fragment. The results showed that the accuracy and efficiency of 10 μL Hoechst33342 staining for 40 min group was significantly better than those of other groups, and the motility of sorted X and Y sperms was similar to that of 20 μL Hoechst33342 staining for 20 min group, which was significantly higher than that of other groups (P<0.05). The addition of 5 μmol·L-1 Allura Red had no significant effect on the purity of sorted sperms (P>0.05), but significantly improved the sperm motility after sorting (P<0.05). After sorting, X and Y sperms were fertilized with oocytes in vitro, there was no significant difference in fertilization rate and the developmental potential of early embryos between the sorted group and unsorted group(P>0.05), and the sex ratio of embryos was consistent with the purity of sorted sperms. In summary, the method of sorting yak X, Y sperm by flow cytometer was established and optimized in this study, and adding Allure Red could improve the sperm motility after sorting, which laid a foundation for the preparation and production of yak sex controlled semen.
Establishment of the Culture System in Vitro and Functional Identification of Mouse Spermatogonial Stem Cells
ZHANG Xianyu, ZHAO Xin, LI Guoling, XING Pingping, LI Zicong, YANG Huaqiang, WU Zhenfang, CHEN Bin
2021, 52(2):  408-419.  doi:10.11843/j.issn.0366-6964.2021.02.013
Abstract ( 539 )   HTML( )   PDF (4832KB) ( 809 )  
References | Related Articles | Metrics
The objective of the present study was to provide a reference for in vitro culture of spermatogonial stem cells (SSCs) for other strain mice and megafauna by exploring the SSCs stable culture from ICR strain mice. Testes were harvested from 6-8 days old postpartum ICR male pups and digested using a two-step enzymatic (collagenase and trypsin) digestion protocol, then SSCs were purified by differential adherent method. The growth of SSCs in vitro culture was detected by using different feeder layers (mouse embryonic fibroblasts as feeder layer or laminin combined with polylysine), different media (StemPro-34 medium or DMEM medium) and different growth factors(recombinant rat glial-cell-line-derived neurotrophic factor (GDNF), recombinant mouse leukemia inhibitory factor (LIF), epidermal growth factor (EGF), recombinant human basic fibroblast growth factor (bFGF), insulin-like growth factors-1 (IGF1)). Proliferation of SSCs in the F6 was evaluated by immunostaining and molecular detection. Finally, stable proliferative SSCs in vitro were transplanted into recipient testes for functional identification. The results showed that SSC cells with purity higher than 79% could be achieved by two-step enzymatic digestion and differential adherent method; Using mouse embryonic fibroblasts as feeder layer, StemPro-34 as base medium, and adding GDNF, LIF, EGF, bFGF, IGF1 composite growth factors, the proli-feration and long-term culture of SSCs in vitro were observed. SSC colonies showed positive signals by alkaline phosphatase (AKP) immunostaining, and promyelocyte leukemia zinc-finger factor (PLZF) and ubiquitin C-terminal hydrolase L1 (UCHL1) immunofluorescence detection. Moreover, the high expression of pluripotent and self-renewal genes in colonies indicated the stable proliferation of SSCs by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time PCR (qRT-PCR) testing. After transplanting SSCs (with the enhanced green fluorescent protein (EGFP) reporter gene) into recipient testes, the heads of sperm in the epididymides emitted green light, indicating the sperm originated from the donor-SSCs. The results illustrated that the culture system obtained in this study was suitable for SSCs in vitro culture of ICR strain mice, and cells cultured in vitro had normal biological function. This study provided a reference for in vitro culture of spermatogonial stem cells of other strain mice and megafauna.
A Study on the Factors Influencing the Superovulation and Embryo Production in Australian Wagyu Beef
ZHAO Shanjiang, SUI Heming, HAO Haisheng, HU Zhihui, PANG Yunwei, ZOU Huiying, DU Weihua, ZHAO Xueming, ZHU Huabin
2021, 52(2):  420-428.  doi:10.11843/j.issn.0366-6964.2021.02.014
Abstract ( 540 )   HTML( )   PDF (961KB) ( 787 )  
References | Related Articles | Metrics
The study aimed to analyze the effects of different developmental stages (young and postpartum Wagyu), synchronization methods, follicle-stimulating hormone (FSH) dosage and superovulation times on superovulation efficiency and embryo production in Australian Wagyu beef. In this experiment, 38 young Wagyu (16-20 months old) and 42 postpartum Wagyu (first born) were selected for superovulation treatment. The number of total embryos, usable embryos, different grades embryos and the unavailable embryos were counted respectively, and then the data of superovulation efficiency and embryo production of each experimental group were compared and analyzed. The results showed that: 1) The rate of efficient superovulation in postpartum Wagyu ((95.46±2.58)%) was significantly higher than that in heifer((77.55±6.02)%, P<0.05), and the number of total embryos (12.30 vs 10.37), usable embryos (8.97 vs 7.66) and grade A degree embryos (3.86 vs 2.50) were also higher than those in heifer (P>0.05); 2) There was no significant difference in the rate of efficient superovulation among different simultaneous treatments (spontaneous estrus, PG and implanted CIDR) before superovulation, but the average usable embryos per donor bovine in spontaneous estrus group (11.22±2.33) was significantly higher than that in PG group (6.09±1.05) (P<0.05); 3) Different doses of FSH could significantly affect the rate of efficient superovulation of donor and the number of average unavailable embryos per donor. The rate of efficient superovulation of heifer in 120 mg FSH group ((55.56±17.57)%) was significantly lower than that in 200 mg FSH group ((88.00±6.63)%) and 220 mg FSH group ((73.33±11.82)%) (P<0.05). The number of average unavailable embryos per donor of postpartum beefs in 220 mg FSH group (2.28±0.65) was significantly lower than that in 250 mg FSH group (5.00±1.38) (P<0.05); 4) The superovulation times significantly affected the rate of efficient superovulation of heifer and the number of average unavailable embryos per donor of postpartum beefs. The first rate of efficient superovulation of heifer ((70.27±7.62)%) was significantly lower than that of the second superovulation (100%) (P<0.05). The number of unavailable embryos recovered in the second superovulation(4.44±0.92) was significantly higher than that in the first superovulation (2.39±0.40) (P<0.05). Therefore, under the existing level of production management in North China, the superovulation donor should select the parturient cow, and the total dose of superovulation FSH should be 240 mg, which will provide technical and theoretical basis for the high efficiency production of embryos and the establishment of core groups in Wagyu.
ANIMAL NUTRITION AND FEEDS
Effects of Copper Supplemental Level on Fur Quality, Serum Biochemical Indices and Liver Related Genes Expression of Fur Growing Raccoon Dog
ZHANG Xinyu, LIU Chaonan, YANG Qianlong, HAN Feifei, ZHANG Ruchun, LI Guangyu, LIU Hanlu
2021, 52(2):  429-439.  doi:10.11843/j.issn.0366-6964.2021.02.015
Abstract ( 478 )   HTML( )   PDF (1676KB) ( 1002 )  
References | Related Articles | Metrics
This experiment was conducted to study the effects of dietary copper on the fur quality, organ index, serum biochemical indices and relative genes expression of fur growing Raccoon dogs. One hundred and five healthy male Raccoon dogs were randomly divided into 7 groups with 15 replicates per group and 1 Raccoon dog per replicate. The Raccoon dogs were fed 7 diets with different copper supplemental levels (as methionine chelated copper):0 (control group), 30(group Ⅰ), 45(group Ⅱ), 60 (group Ⅲ), 75 (group Ⅳ), 90 (group Ⅴ) and 200 mg·kg-1 (group Ⅵ). The pre-test period lasted for 7 days and the trial period lasted for 60 days. At the end of the experiment, 8 Raccoon dogs in each group were selected for blood collection and slaughter. The related indices and genes expression were detelted. The results showed as follows: 1) Copper addition level had a significant effect on the skin length, body length, guard hair fibre length, guard hair fibre fineness(P<0.05), but had no significant effect on skin weight, underfur hair fibre length, underfur hair fibre fineness. 2) Dietary copper su-pplementation had no significant effect on the heart index, liver index, kidney index and spleen index of Raccoon dogs. 3) With the increase of copper level, serum GLU content also significantly increased (P<0.05), and different copper addition doses had significant effects on serum LDH, AST and ALT activity (P<0.05), and the serum CER, T-SOD and Cu-Zn SOD activity increased first and then tended to be stable (P<0.05). 4) Different dietary copper levels had significant on Liver CER, Cu-Zn SODGHRIGF-1 genes expression. The expression levels of CER and Cu-Zn SOD genes in the liver of the groups of 90 and 200 mg·kg-1 were significantly higher than that in the group of 30 mg·kg-1, and the expression levels of CER and Cu-Zn SOD genes in the group of 30 mg·kg-1 were significantly higher than that in control group (P<0.05). The expression level of GHR and IGF-1 genes in the group of 90 mg·kg-1 were significantly higher than that in the control group (P<0.05).When the dietary copper level was 60-75 mg·kg-1, the fur quality of Raccoon dogs was the best; The CER and Cu-Zn SOD activity in serum did not change significantly with the change of copper level and there was no significant change in serum AST, ALT and LDH enzyme activity; in addition, the expression of GHR and IGF-1 genes in liver increased to promote the growth of Raccoon dogs. Combined with the above determination indicators, it is recommended that the dietary copper content of Raccoon dogs is 60-75 mg·kg-1.
PREVENTIVE VETERINARY MEDICINE
Construction of BHK-21 Cell Line Stably Expressing TIGAR Gene and Evaluation of Its Proliferation Effect on Newcastle Disease Virus
LI Yonghua, LIU Wei, XU Zhikai, LIU Weiwei, SUN Yingjie, QIU Xusheng, TAN Lei, SONG Cuiping, LIAO Ying, DING Chan, MENG Chunchun
2021, 52(2):  440-449.  doi:10.11843/j.issn.0366-6964.2021.02.016
Abstract ( 538 )   HTML( )   PDF (4006KB) ( 392 )  
References | Related Articles | Metrics
TP53-induced glycolysis and apoptosis regulator, TIGAR is a target gene downstream of p53, which has the functions of regulating glycolysis and anti-apoptosis. Since the Newcastle disease virus (NDV) causes cell death by inducing apoptosis, increasing the anti-apoptotic level of host cells will prolong cell survival time and increase the titer of progeny viruses. In this study, primers were designed based on the predicted TIGAR gene of hamster and chicken on GenBank. Amplified the TIGAR gene to construct lentivirus packaging plasmid, then construct of the stable expression cell lines (BHK-21-chTIGAR and BHK-21-hamTIGAR) with helper plasmid. Western blot, DNA sequencing, and qPCR were used to identify cell lines. Western blot and flow cytometry was used to evaluate the apoptosis rate of cells. Three NDV strains with high, medium, and low pathogenicity, were selected to infect the constructed cell lines and to compare the virus titer with the wild-type BHK-21. The results of Western blot and DNA sequencing showed that the recombinant cell lines, BHK-21-chTIGAR cells and BHK-21-hamTIGAR cells, were successfully constructed and with high expression levels of the TIGAR gene without wild-type BHK-21 cells contamination. The stability of the cell lines detected by qPCR showed that the TIGAR gene can be continuously expressed after 30 times passages. The natural apoptosis rate of BHK-21-hamTIGAR cells was much lower than that of BHK-21-chTIGAR cells and wild-type BHK-21 cells. The virus growth curve demonstrated that no matter high, medium, and low pathogenicity of NDV strain all have higher virus titer in BHK-21-hamTIGAR cells compared to BHK-21-chTIGAR cells and wild-type BHK-21 cells. In conclusion, the BHK-21-hamTIGAR cell line has the obvious anti-apoptotic effect and is conducive to support the high-level replication of NDV. It has the potential to be further modified as a suitable cell line to produce NDV vaccines NDV for preparing vaccines.
Programmed Cell Death Factor 10 Inhibits Type Ⅰ Interferon Expression and Promotes the Replication of Foot-and-mouth Disease Virus
ZENG Zongbo, MA Xusheng, LUO Zhikuan, QI Yayin, ZHENG Haixue
2021, 52(2):  450-459.  doi:10.11843/j.issn.0366-6964.2021.02.017
Abstract ( 448 )   HTML( )   PDF (2549KB) ( 429 )  
References | Related Articles | Metrics
The purpose of this study is to explore how the host protein programmed cell death factor 10 (PDCD10) can inhibit the expression of type Ⅰ interferon to promote the replication of foot-and-mouth disease virus (FMDV). First, this study verified the effect of overexpression and silencing of PDCD10 on FMDV replication. Secondly, the dual-luciferase reporter system was used to explore the effect of PDCD10 on the activation of type Ⅰ interferon signaling pathway. Finally, real-time fluorescent quantitative PCR was used to explore the effect of PDCD10 on the transcription of stimulating genes downstream of the type Ⅰ interferon pathway. The results showed that overexpression of PDCD10 significantly promoted FMDV replication while silencing PDCD10 significantly inhibited FMDV replication. Compared with the control, the cell culture supernatant infected with Sendai virus (SeV) after overexpression of PDCD10 significantly promoted FMDV replication. Furthermore, PDCD10 significantly inhibited the activation of IFN-β promoter and NF-κB induced by SeV in a dose-dependent manner, and PDCD10 negatively regulated the transcription of type Ⅰ interferon pathway signal molecules. Finally, it was found that PDCD10 negatively regulated the transcription of ISGs downstream of type Ⅰ interferon. The results of this study have accumulated data for the in-depth exploration of the role of PDCD10 in antiviral innate immunity.
Transcriptome Analysis of MDBK Cells Infected with Lumpy Skin Disease Virus
CAO Zheng, JUMABIEKE Xialabayi, LI Chunyan, MALIKE Aizezi
2021, 52(2):  460-468.  doi:10.11843/j.issn.0366-6964.2021.02.018
Abstract ( 655 )   PDF (3790KB) ( 695 )  
References | Related Articles | Metrics
To explore the interaction between LSDV and host cells, in this study, cattle skin samples with typical lesions of LSD was collected, and MDBK cells were inoculated for virus isolation. Skin lesions and infected MDBK cells were observed by transmission electron microscopy. Besides, transcriptomics analysis was performed on MDBK cells 24 hours after infection to screen differentially expressed genes, classify them according to their functions, and analyze the cell signaling pathways involving them. The results showed that LSDV was elliptic under electron microscope and the virion size was about 320 nm×260 nm. Compared with the untreated group, a total of 499 genes were significantly differentially expressed, among which 112 genes were up-regulated and 387 genes were down-regulated through transcriptome analysis. According to GO and KEGG analysis, the differentially expressed genes were mainly concentrated in the MAPK signaling pathway that transmits signals from the cell surface to the inside of the nucleus, in which the expression of MAP3K1 gene, which is involved in innate immunity and associated in apoptosis, showed significant downregulation, suggesting that this viral infection may affect the migration and apoptosis of host cells. The significantly changed genes include HIF1A, RORA, LRRK2, AP3B1 and ANO6, which are respectively involved in functions such as regulating vascular endothelial growth factor (VEGF), inflammatory response, proliferation and differentiation of cells and signal transduction. This study laid a foundation for further exploring the pathogenic mechanism of LSDV.
Detection and Genomic Characteristics of Bovine Torovirus in Yak
ZHAO Long, TANG Cheng, YUE Hua
2021, 52(2):  469-477.  doi:10.11843/j.issn.0366-6964.2021.02.019
Abstract ( 498 )   HTML( )   PDF (2572KB) ( 426 )  
References | Related Articles | Metrics
The purpose of this study was to investigate the presence of bovine torovirus (BToV) in yak in Qinghai-Tibetan Plateau and to analyze the characteristics of the BToV genome. An RT-PCR assay was used to detect BToV from clinical samples from Tibet, Qinghai and Sichuan, and the BToV genome was further amplified from the positive sample. Approximate 6.9% (10/145) diarrheic samples were detected as BToV positive, and the positive rate in Tibet, Qinghai and Sichuan was 11.8%, 8.9% and 3.0% respectively. Moreover, a complete BToV genomic sequence was obtained from a positive sample, which was 28 314 nucleotides in length with a GC content of 36.31%. The genome in this study shared 82%-97% nucleotide sequence identity with the 5 BToV genomic sequences in the GenBank database. It shared the highest sequence identity and the closest genetic relationship with the native BToV genome SC2. Compared with all 14 complete BToV-S gene sequences in the GenBank database, the S gene of the BToV genome in this study had 8 unique amino acid variations which include 6 variations in the S1 domain and 2 variations in the S2 domain. Besides, a recombinant event was predicted in the region of 222-2 473 bp of the S gene. In conclusion, this research revealed that BToV could infect yak with wide geographical distribution. Furthermore, a genotype Ⅲ BToV genome was obtained, and a recombinant event was predicted in its S gene. The results of this study would be helpful for a better understanding of BToV's molecular characteristics and genetic evolution.
Establishment of Apoptosis Associated Dot Like Protein Knockout PK-15 Cell Line and Its Effect on Porcine Pseudorabies Virus Infection
ZHAI Yunyun, LI Jiajia, ZHANG Shuang, REN Ziyu, JIN Qianyue, DU Yongkun, WAN Bo
2021, 52(2):  478-487.  doi:10.11843/j.issn.0366-6964.2021.02.020
Abstract ( 536 )   HTML( )   PDF (2386KB) ( 434 )  
References | Related Articles | Metrics
This study aimed to investigate the effect of ASC gene knockout on the infection of pseudorabies virus (PRV) in PK-15 cells. The CRISPR/Cas9 gene-editing technology mediated by lentivirus was applied to knock out the ASC gene of porcine renal epithelial cell (PK-15), and the efficiency was detected with T7 endonuclease. Flow cytometry was applied to detect the difference of PRV-GFP proliferation between in PK-15 and PK15-ASC-/- cells. The transcription levels of PRV-gB, IL-1β, IFN-β, ISG15 genes and the expression of PRV-gE protein were tested with RT-PCR and Western blot, the titer of progeny PRV was determined with TCID50 method. The results showed that specific sgRNA could carry out efficient gene editing for ASC gene, and the activity of PK15-ASC-/- cells was not significantly affected. After infection, the proliferation of PRV-GFP in PK15-ASC-/- cells was significantly inhibited compared with that in PK-15 cells. Besides, both the transcription level of PRV-gB gene and the expression level of PRV-gE protein in PK15-ASC-/- cells were also lower than that in PK-15 cells. Nevertheless, the transcription level of IFN-β and ISG15 gene presented the opposite results. The virus titer test showed that knockout of ASC gene could significantly inhibit the proliferation of PRV progeny virus. In this study, a PK15-ASC-/- cell line was successfully constructed, and in which the PRV infection was significantly inhibited.
Characterization of Prevalence and Antimicrobial Resistance of Salmonella Enterica Serovar London from Markets in Guangzhou
GAO Yuan, WANG Lanqian, ZHANG Lina, FU Ying, ZHANG Jianmin, LIAO Ming, QU Xiaoyun
2021, 52(2):  488-497.  doi:10.11843/j.issn.0366-6964.2021.02.021
Abstract ( 451 )   HTML( )   PDF (861KB) ( 692 )  
References | Related Articles | Metrics
This study aims to explore the prevalence and drug resistance of Salmonella London from pork at the market in Guangzhou from May to October 2016. One hundred and ninety-eight samples were collected from the market in Guangzhou. Twenty-eight strains of S. London from pork were isolated. The KB method was used to test the drug resistance, and the drug-resistant genes were identified by PCR. The results showed that the positive rate of Salmonella from pork was 74. 2% (147/198), the isolation rate of S. London was 19% (28/147). The drug sensitivity test of S. London showed that they were resistant to sulfisoxazole (78.6%) and tetracycline (75.0%), followed by streptomycin (71.4%), compound sulfamethoxazole (67.9%), ampicillin (67.9%), gentamicin (67.9%), chloramphenicol (46.4%) and florfenicol (42.8%), respectively. Also, the antibiotic resistance to nalidixic acid (3.6%) and polymyxin B (3.6%) is rare. And 71.4% (20/28) of the strains were resistant to three or more antimicrobial agents. The detection rate of β-lactam resistance gene blaTEM is 10.7%; the detection rates of quinolone resistance genes qnrA, oqxAB and aac(6')-lb-cr are 3.6%, 10.7% and 7.1%, respectively. Only 3.6% of the isolates carried colistin resistance gene mcr-1. It was found that S. London was one of the major epidemics in pork from markets in Guangzhou. It is highly resistant to traditional antimicrobials such as sulfisoxazole, tetracycline, streptomycin, compound sulfamethoxazole, ampicillin, carrying multiple drug-resistant genes, and has multi-drug resistant phenotypes. These results suggest that we need to conduct normalized detection and monitoring of Salmonella in the market, strengthen the supervision of the use of antibiotics, and ensure public health and food safety.
BASIC VETERINARY MEDICINE
Preparation of Bovine Surfactant Protein A and Its Antibacterial Activities
LI Nan, ZHANG Jianlou, ZHANG Yonghong, ZHENG Zhiqiang, HUO Shanshan, ZHONG Fei, ZHAI Xianghe
2021, 52(2):  498-505.  doi:10.11843/j.issn.0366-6964.2021.02.022
Abstract ( 448 )   HTML( )   PDF (1731KB) ( 454 )  
References | Related Articles | Metrics
To isolate natural bovine lung surfactant protein A (SP-A) and analyze its antibacterial activities, the maltose-sepharose (MS) beads specifically binding bovine SP-A was prepared by the covalently crosslinking method. The MS beads were used to absorb the bovine SP-A from bovine lung lavage. SDS-PAGE and Western blot detections showed that two forms of SP-A, 30 ku monomer and 60 ku dimer, were detected in the bovine SP-A preparation. The SP-A was identified as possessing the ability to aggregate E. coli, suggesting it possesses biological activity. The antibacterial experiment showed that SP-A significantly inhibited the growth of Staphylococcus aureus, Streptococcus agalactiae and the pathogenic E. coli, especially for Gram-negative bacteria with high inhibition activity, indicating that the bovine SP-A prepared in this study possesses antibacterial activities. This study provided necessary conditions for further investigation on SP-A biological characteristics and antibacterial activities, as well as opened up a new way for the development of SP-A antibacterial reagent.
Effects of Autophagy Regulators on Apoptosis in the Brain of Mice Infected with Japanese Encephalitis Virus
ZHANG Jinhua, GAO Mingxing, LIU Zelin, GU Changqin
2021, 52(2):  506-514.  doi:10.11843/j.issn.0366-6964.2021.02.023
Abstract ( 489 )   HTML( )   PDF (3450KB) ( 719 )  
References | Related Articles | Metrics
This experiment was conducted to study the effect of autophagy-regulating drugs on brain cell apoptosis in mice infected with Japanese encephalitis virus (JEV). An animal model was established by treating JEV infected mice with autophagy-regulating drugs. Rapamycin is an autophagy inducer, and wortmannin and chloroquine are autophagy inhibitors. The experimental animals were divided into 8 groups as follows: DMEM control group (Control); JEV infection group (JEV); JEV+rapamycin group (JEV+Rapa); JEV+Wortmannin group (JEV+Wort); JEV+chloroquine group (JEV+CQ); Rapamycin group (Rapa); Wortmannin group (Wort); Chloroquine group (CQ). The clinical symptoms and the degree of mitochondrial damage of neurons and glial cells in the brain of mice were observed. Besides, we examined the distribution of apoptotic cells in the brain of mice and detected the expression of apoptotic factors and apoptotic proteins in the brain of mice. Compared with the JEV+Rapa and JEV groups, the mice in the JEV+Wort and JEV+CQ groups showed mild neurological symptoms, and the mitochondria of neurons and glial cells were mildly damaged, and fewer cells showed apoptosis in the brain. There was no significant difference in the expression of apoptotic factors and apoptotic proteins in the brain of mice in different treatment groups. The results of this study suggested that autophagy inhibitors Wormantin and Chloroquine can partly inhibit the occurrence of apoptosis in the brain tissue of mice infected with JEV.
Effect of CnAβ Gene on Degranulation of Rat RBL-2H3 Cells
LI Yanhong, LIU Jie, WU Zhengli
2021, 52(2):  515-524.  doi:10.11843/j.issn.0366-6964.2021.02.024
Abstract ( 513 )   PDF (5150KB) ( 517 )  
References | Related Articles | Metrics
Allergy is a common disease in humans and farmed animals, and it develops quickly. To insight into the molecular mechanism of allergic disease, this study was focused on the function of calcineurin A beta (CnAβ) gene on RBL-2H3 cell degranulation. CRISPR/Cas9 gene editing technology was employed to construct CnAβ gene knockout RBL-2H3 cell line, and the proliferation and degranulation of RBL-2H3 cell effected by CnAβ gene were surveyed. The first exon of rat CnAβ gene was selected as a knockout target for the design and synthesis of three single guide RNAs (sgRNA), to construct the pX459-CnAβ-sgRNA knockout plasmid, and the constructed plasmid was transferred into RBL-2H3 cells by Lipofectamine 3000. After puromycin screening, the RBL-2H3 cell line with CnAβ gene deletion was obtained by PCR and DNA sequencing, and then used to detect the effect of CnAβ gene deletion on cell proliferation and degranulation. The results indicated that CnAβ gene knockout RBL-2H3 cell line was successfully constructed, and CnAβ deficiency had no significant effect on the proliferation, granule formation or granule content of RBL-2H3 cell, but significantly inhibited the degranulation of RBL-2H3 cells mediated by cell surface receptors. This research will contribute to an in-depth understanding of the mechanism of animal allergic diseases and provide a theoretical basis for the prevention of allergic disease.
CLINICAL VETERINARY MEDICINE
Screening of Antibacterial Activity of Artemisia Oil from Different Sources and Preliminary Study on Its Antibacterial Activity against Staphylococcus aureus
GAO Yue, WANG Wanlin, PENG Junchao, CAI Yaling, LIAO Jiamei, YI Qiong, WANG Lu
2021, 52(2):  525-534.  doi:10.11843/j.issn.0366-6964.2021.02.025
Abstract ( 624 )   HTML( )   PDF (2000KB) ( 399 )  
References | Related Articles | Metrics
This study aimed to screen Blumea balsamifera oil (BBO) with good antibacterial activity, seek antibacterial active substance, and preliminarily analyze its antibacterial activity against Staphylococcus aureus (S. aureus). BBO from different sources (A1-A5) and home-made (B1-B9, T) were screened by antibacterial test to S. aureus, Escherichia coli (E. coli), Pseudomons adaceae (P. arugino.sa), Streptococcus agalactiae (GBS), Candida albicans in vitro, the main chemical constituents were analyzed by GC-MS, and its MIC and MBC was also evaluated. Also, the protective effects of BBO T in mice infected with S. aureus, and its effect on the bacterial growth curve and bacterial morphology were both determined. The results showed that BBO B9 and T had the best antibacterial effect. The MIC values for S. aureus and P. arugino.sa were 9.77, 13.68 μg·mL-1, and MBC values were 19.54 and 27.35 μg·mL-1, respectively. Thirty-six common chemical constituents were detected from BBO B5, B9 and T, in which α-Humulene, pinene and linalool had certain antibacterial activity. Different concentrations of BBO T solution could inhibit the death of mice induced by S. aureus in different degrees, and significantly reduce the splenomegaly, white spots in kidney and renal tissue necrosis in mice (P<0.01). The low concentration of BBO T solution could delay the strain to enter the logarithmic growth phase, and the high concentration could kill the bacteria, change the cell morphology and break up the cells. These results suggest that BBO T is of good quality and has good antibacterial activity in vivo and in vitro. It exerts antibacterial effect by destroying the structure of bacteria and inhibiting the growth of strains. α-Humulene, pinene and linalool in BBO may be the key antibacterial substances, which can be used for further development and research.
The Apoptotic Effect of Zearalenone on Goat Endometrial Stromal Cells
WANG Zongjie, ZHANG Ruixue, LIU Shouqin, JIN Yaping, LIN Pengfei
2021, 52(2):  535-542.  doi:10.11843/j.issn.0366-6964.2021.02.026
Abstract ( 529 )   HTML( )   PDF (1955KB) ( 571 )  
References | Related Articles | Metrics
Zearalenone (ZEN) is a fungal toxin with cytotoxic and estrogenic activity which is produced by Fusarium, ZEN has serious toxic impacts on the reproductive system, urinary system and digestive system. At present, the potential mechanism of ZEN on apoptosis of goat endometrial stromal cells (ESCs) remains unclear. In this study, we studied the effect of ZEN on the proliferation and apoptosis of goat ESCs by CCK-8 and flow cytometry in vitro. To investigate whether ZEN affected the proliferation and apoptosis of goat ESCs through endoplasmic reticulum stress (ERS), Real-time PCR and Western blot were used to detect the gene expression levels of ERS and apoptosis. The results showed that ZEN inhibited the proliferation of goat ESCs in a dose-dependent manner. With the increase of ZEN dose, the apoptosis rate of goat ESCs increased significantly. ZEN dose-dependent up-regulation of Caspase-8, Caspase-9 and Bax/Bcl-2 mRNA expression levels. ZEN could significantly up-regulate the expression levels of GRP78 and CHOP mRNA and protein. Meanwhile, the expression levels of ATF6, PERK and IRE1 mRNA were drastically increased. In contrast, the IRE1 pathway could be significantly affected by ZEN. Addition of ERS specific inhibitor 4-PBA or IRE1 specific inhibitor Irestatin 9389 significantly reduced the inhibitory effect of ZEN on ESCs proliferation. These results indicated that ZEN could regulate the apoptotic process of ESCs in goats through the ERS pathway.
Gut Bacteria of Gout Gosling Promoted Kidney Injury Through LTR4/MyD88/NF-κB Signaling Pathway
ZHU Daoxian, WU Zhi, LU Jiang, HUANG Tao, LIU Li
2021, 52(2):  543-552.  doi:10.11843/j.issn.0366-6964.2021.02.027
Abstract ( 584 )   HTML( )   PDF (6481KB) ( 391 )  
References | Related Articles | Metrics
This study aimed to investigate the effect of gut microbiota on renal injury and its mechanism in gout gosling. In this study, 15 goslings with typical gout characteristics and 15 healthy goslings of the same age and growth environment were selected. 16S rDNA sequencing technology was used to analyze the difference of bacterial diversity in cecal contents. Serum creatinine (Cr), uric acid (UA) and urea nitrogen (BUN) were respectively measured by modified picric acid method, enzyme colorimetric method and urease glutamate dehydrogenase method. RT qPCR and Western blot were respectively used to detect the mRNA and protein expressions of toll-like receptor 4 (TLR4), myeloid differentiation factor (MyD88), nuclear transcription factor-κB (NF-κB), interleukin-1β (IL-1β), tumor necrosis factor-ɑ (TNF-ɑ) and interleukin-6 (IL-6). Lastly, the gut microbiota was transplanted into sterile mice for the verification test. The results showed that: 1) Compared with healthy goslings, the number of operational taxonomic units (OTUs), Chao 1 index and Shannon index of gut microbiota in gout goslings were significantly decreased (P<0.01), and the abundance of Proteobacteria, Escherichia, Proteus and Enterococcus increased significantly. The gut microbiota of gout goslings had higher participation in the immune system, bacterial infection, membrane transport and nucleotide metabolism. 2) Compared with healthy goslings, the mRNA and protein expressions of TLR4, MyD88, NF-κB, IL-1β, TNF-α and IL-6 in kidney tissue of gout goslings were significantly increased (P<0.05 or 0.01). The mRNA expression levels of these molecules were positively correlated with Cr, BUN and UA, and strongly positively correlated with the abundance of Escherichia, Proteus and Enterococcus. 3) The mRNA expression of TLR4, MyD88, NF-κB in kidney tissue and the levels of Cr, BUN and KIM-1 in blood of mice transplanted gut microbiota of gout gosling were significantly higher than those of mice transplanted gut microbiota of healthy gosling. These changes could be reversed by TAK-242. In summary, gut microbiota changed in gout gosling can activate LTR4/MyD88/NF-κB signaling pathway, induce inflammatory response, and promote kidney injury.
RESEARCH NOTES
Genome Sequencing and Phylogenetic Analysis of Senecavirus A, CH-HNCY-2019
LI Ning, GUO Huifang, WANG Baiyu, QIAO Qilong, HUANG Qing, LI Yongtao, WANG Zeng, ZHAO Jun
2021, 52(2):  553-559.  doi:10.11843/j.issn.0366-6964.2021.02.028
Abstract ( 533 )   HTML( )   PDF (1471KB) ( 639 )  
References | Related Articles | Metrics
This study aimed to analyze genomic properties and evolution of a Senecavirus A (SVA) strain CH-HNCY-2019. Eight pairs of primers were designed based on the genome sequence of SVV-001 (GenBank No. NC011349) and fragments covering the whole genome of strain CH-HNCY-2019 were amplified by RT-PCR. The whole-genome sequence of CH-HNCY-2019 was determined and analyzed. Results showed that the complete genome of CH-HNCY-2019 is composed of 7 294 nucleotides. The phylogenetic evolutionary analysis of the entire genome demonstrated that CH-HNCY-2019 shares 95.9% to 99% nucleotide similarities with Chinese SVA isolates, and has the lowest nucleotide identity with the representative American strain SVV-001. The CH-HNCY-2019 strain has a close phylogenetic relationship with most of Chinese SVA isolates in 2017 and 2018 and a distant genetic relationship with SVA strains isolated in 2015 and 2016 in China. Comparing to the domestic and foreign isolates including four SVA strains isolated in Guangzhou, China in 2019, amino acid substitutions were observed in the CH-HNCY-2019 strain at VP1 position 722 (L to Q) and VP3 position 499 (A to V), 528 (P to S), and 582 (E to K). The whole-genome sequence of SVA CH-HNCY-2019 was successfully obtained in this study. Sequence analysis results implied the diversity and continuous evolution of current Chinese SVA isolates. SVA molecular epidemiological investigation is critical in comprehensive understanding of the prevalence of SVA in China and provides a solid background for formulating strict biosecurity management and vaccine development to prevent the widespread of SVA in Chinese pig herds.
Establishment of a Loop-Mediated Isothermal Amplification Method for Rapid Detection of Salmonella Indiana
GONG Jiansen, XU Jingxiao, FU Lixia, ZHANG Di, DONG Yongyi, XU Bu, DOU Xinhong
2021, 52(2):  560-564.  doi:10.11843/j.issn.0366-6964.2021.02.029
Abstract ( 469 )   HTML( )   PDF (555KB) ( 427 )  
References | Related Articles | Metrics
The objective of the present study was to establish a molecular method for rapid detection of Salmonella Indiana and overcome the shortcomings of traditional detection method rely on selective isolation, biochemical identification and serological typing. In this study, comparative genomics was used to identify the serospecific gene for S. Indiana, and a set of primers for LAMP was further designed. The specific molecular detection method for S. Indiana was established by optimizing the reaction conditions. The results showed that the method was specific and time-consuming, and the detection limit was 59 copies per reaction. The results of this method are consistent with GB4789.4—2016, and can also be used for the detection of self-coagulating bacteria. The detection method established in this study can rapid detection of S. Indiana, and will play an important role in the clinical diagnosis of this pathogen.