Acta Veterinaria et Zootechnica Sinica ›› 2024, Vol. 55 ›› Issue (11): 4938-4949.doi: 10.11843/j.issn.0366-6964.2024.11.014
• Animal Genetics and Breeding • Previous Articles Next Articles
Shuang XU(), Juan DU, Kaiyi ZHANG, Jiakun MIAO, Yu YANG, Yanfang WANG, Shulin YANG*(
)
Received:
2024-04-16
Online:
2024-11-23
Published:
2024-11-30
Contact:
Shulin YANG
E-mail:xushuangjlu@163.com;yangshulin@caas.cn
CLC Number:
Shuang XU, Juan DU, Kaiyi ZHANG, Jiakun MIAO, Yu YANG, Yanfang WANG, Shulin YANG. Molecular Pathological Mechanisms of Subcutaneous Fat Dysfunction in Metabolic Disease Susceptible Pigs[J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(11): 4938-4949.
Table 1
Primers information"
引物名称 Primers name | 引物序列(5′→3′) Primers sequence | 产物大小/bp Product size |
NDUFA4-F | ATCCAGATGTCTGTTGGGACA | 199 |
NDUFA4-R | GTGGAAAATTGTGCGGATGG | |
NDUFA6-F | GTGCCGAACACTGTGCATTTA | 232 |
NDUFA6-R | ACAGGAAATCCGTTGGCCTT | |
NDUFB10-F | ACAAGGACGTGTACCCTGAG | 149 |
NDUFB10-R | CTGCTGCTCGATAAACTCTCTC | |
COX6C-F | GGTTTCACCTTATTGCCGCC | 202 |
COX6C-R | GGTTCAGCCACAGCAAACTTA | |
OPA1-F | AGACTTTTTCACCACAGGTTCAC | 105 |
OPA1-R | ATGAGCTCACCAAGCAGACC | |
ACLY-F | GGCCTTTCGTAGAGAGCAGG | 281 |
ACLY-R | CCATCCAGGGTGAGGTTGAC | |
ACSS2-F | GTGTCGGGAGAAGGGTTTCC | 133 |
ACSS2-R | GGAGATCTGCATATCCGGGC | |
FASN-F | TCCAAGGAGCAAGGTGTGAC | 224 |
FASN-R | CCCATGTTCGACTTGGTGGA | |
18S-F | GTAACCCGTTGAACCCCATT | 151 |
18S-R | CCATCCAATCGGTAGTAGCG |
Fig. 1
Serological indices and adipose tissue cell area statistics A-D. Serum triglyceride, free fatty acid, leptin, and adiponectin concentrations in each group; E. Representative images of adipose tissue HE staining (20×); F. Adipose tissue cell area statistics, *P < 0.05, ** P < 0.01. The same as below"
Fig. 3
Analysis of WT-12/WT-3 and TG-12/TG-3 GSEA and DEGs A. GSEA-enriched pathway for WT-12/WT-3; B. GSEA-enriched pathway for TG-12/TG-3; C. Heatmap of DEGs enriched to oxidative phosphorylation; D. Heatmap of DEGs enriched to the chemokine signaling pathway; E. Heatmap of DEGs enriched to the complement and coagulation cascade"
Fig. 4
Comparison of WT-12/WT-3 and TG-12/WT-3 GSEAs and DEGs A-B. Comparison of WT-12/WT-3 and TG-12/(WT)-3 GSEA-enriched pathways; C-D. Comparison of WT-12/WT-3 and TG-12/WT-3 DEGs; E. mtDNA heatmap. Green genes are OXPHOS genes, orange genes are glycolipid metabolism-related genes, and black genes are inflammation-related genes"
Fig. 5
qPCR and Western blot validation of DEGs A. qPCR validation of DEGs; B-C. Western blot validation of mitochondrial nuclear-encoded genes and mtDNA; D-E. Western blot validation of acetyl coenzyme A-related genes. Mitochondrial nuclear-encoded genes: NDUFA4, NDUFA6, NDUFB10, COX6C, ATP5A; mtDNA: ND5, COX1; Acetyl coenzyme A synthetase: ACLY, ACSS2; Fatty acid synthetase: FASN"
1 |
MENENDEZ A , WANCZYK H , WALKER J , et al. Obesity and adipose tissue dysfunction: from pediatrics to adults[J]. Genes (Basel), 2022, 13 (10): 1866.
doi: 10.3390/genes13101866 |
2 |
KAWAI T , AUTIERI M V , SCALIA R . Adipose tissue inflammation and metabolic dysfunction in obesity[J]. Am J Physiol Cell Physiol, 2021, 320 (3): C375- C391.
doi: 10.1152/ajpcell.00379.2020 |
3 |
IBRAHIM M M . Subcutaneous and visceral adipose tissue: structural and functional differences[J]. Obes Rev, 2010, 11 (1): 11- 18.
doi: 10.1111/j.1467-789X.2009.00623.x |
4 |
HEINONEN S , JOKINEN R , RISSANEN A , et al. White adipose tissue mitochondrial metabolism in health and in obesity[J]. Obes Rev, 2020, 21 (2): e12958.
doi: 10.1111/obr.12958 |
5 |
PIETROCOLA F , GALLUZZI L , BRAVO-SAN PEDRO J M , et al. Acetyl coenzyme A: a central metabolite and second messenger[J]. Cell Metab, 2015, 21 (6): 805- 821.
doi: 10.1016/j.cmet.2015.05.014 |
6 | 王义平, 雷群英. 赖氨酸乙酰化调控细胞代谢的机制[J]. 生命科学, 2018, 30 (4): 447- 454. |
WANG Y P , LEI Q Y . Regulation of cell metabolism by lysine acetylation[J]. Chinese Bulletin of Life Sciences, 2018, 30 (4): 447- 454. | |
7 |
SHVEDUNOVA M , AKHTAR A . Modulation of cellular processes by histone and non-histone protein acetylation[J]. Nat Rev Mol Cell Biol, 2022, 23 (5): 329- 349.
doi: 10.1038/s41580-021-00441-y |
8 |
VERDIN E , OTT M . 50 years of protein acetylation: from gene regulation to epigenetics, metabolism and beyond[J]. Nat Rev Mol Cell Biol, 2015, 16 (4): 258- 264.
doi: 10.1038/nrm3931 |
9 |
ZHANG K Y , TAO C , XU J P , et al. CD8+ T cells involved in metabolic inflammation in visceral adipose tissue and liver of transgenic pigs[J]. Front Immunol, 2021, 12, 690069.
doi: 10.3389/fimmu.2021.690069 |
10 |
夏博策, 张凯艺, 苗佳坤, 等. 猪CPB2基因可变剪接体的克隆及生物信息学研究[J]. 畜牧兽医学报, 2022, 53 (10): 3377- 3390.
doi: 10.11843/j.issn.0366-6964.2022.10.011 |
XIA B C , ZHANG K Y , MIAO J K , et al. Cloning and bioinformatics study of alternative splicing isoforms of pig CPB2 gene[J]. Acta Veterinaria et Zootechnica Sinica, 2022, 53 (10): 3377- 3390.
doi: 10.11843/j.issn.0366-6964.2022.10.011 |
|
11 |
ZHU X F , XIE X , DAS H , et al. Non-coding 7S RNA inhibits transcription via mitochondrial RNA polymerase dimerization[J]. Cell, 2022, 185 (13): 2309- 2323.
doi: 10.1016/j.cell.2022.05.006 |
12 |
HE W J , LI Q G , LI X X . Acetyl-CoA regulates lipid metabolism and histone acetylation modification in cancer[J]. Biochim Biophys Acta-Rev Cancer, 2023, 1878 (1): 188837.
doi: 10.1016/j.bbcan.2022.188837 |
13 |
PENG H Q , ZHANG K Y , MIAO J K , et al. SnRNA-Seq of pancreas revealed the dysfunction of endocrine and exocrine cells in transgenic pigs with prediabetes[J]. Int J Mol Sci, 2023, 24 (9): 7701.
doi: 10.3390/ijms24097701 |
14 |
YANG Q , XU H C , ZHANG H L , et al. Serum triglyceride glucose index is a valuable predictor for visceral obesity in patients with type 2 diabetes: a cross-sectional study[J]. Cardiovasc Diabetol, 2023, 22 (1): 98.
doi: 10.1186/s12933-023-01834-3 |
15 |
SON D H , LEE H S , LEE Y J , et al. Comparison of triglyceride-glucose index and HOMA-IR for predicting prevalence and incidence of metabolic syndrome[J]. Nutr Metab Cardiovasc Dis, 2022, 32 (3): 596- 604.
doi: 10.1016/j.numecd.2021.11.017 |
16 |
WANG L , CONG H L , ZHANG J X , et al. Triglyceride-glucose index predicts adverse cardiovascular events in patients with diabetes and acute coronary syndrome[J]. Cardiovasc Diabetol, 2020, 19 (1): 80.
doi: 10.1186/s12933-020-01054-z |
17 |
RAJA A A , DANDARE A , KHAN M J , et al. Free fatty acid overload targets mitochondria: gene expression analysis of palmitic acid-treated endothelial cells[J]. Genes (Basel), 2022, 13 (10): 1704.
doi: 10.3390/genes13101704 |
18 |
VILARIÑO-GARCÍA T , POLONIO-GONZÁLEZ M L , PÉREZ-PÉREZ A , et al. Role of leptin in obesity, cardiovascular disease, and type 2 diabetes[J]. Int J Mol Sci, 2024, 25 (4): 2338.
doi: 10.3390/ijms25042338 |
19 |
KIM J , OH C M , KIM H . The interplay of adipokines and pancreatic beta cells in metabolic regulation and diabetes[J]. Biomedicines, 2023, 11 (9): 2589.
doi: 10.3390/biomedicines11092589 |
20 |
WANG Z V , SCHERER P E . Adiponectin, the past two decades[J]. J Mol Cell Biol, 2016, 8 (2): 93- 100.
doi: 10.1093/jmcb/mjw011 |
21 |
HEINONEN S , BUZKOVA J , MUNIANDY M , et al. Impaired mitochondrial biogenesis in adipose tissue in acquired obesity[J]. Diabetes, 2015, 64 (9): 3135- 3145.
doi: 10.2337/db14-1937 |
22 |
NOLFI-DONEGAN D , BRAGANZA A , SHIVA S . Mitochondrial electron transport chain: oxidative phosphorylation, oxidant production, and methods of measurement[J]. Redox Biol, 2020, 37, 101674.
doi: 10.1016/j.redox.2020.101674 |
23 |
LI Z P , GURUNG M , RODRIGUES R R , et al. Microbiota and adipocyte mitochondrial damage in type 2 diabetes are linked by Mmp12+ macrophages[J]. J Exp Med, 2022, 219 (7): e20220017.
doi: 10.1084/jem.20220017 |
24 |
HEINONEN S , MUNIANDY M , BUZKOVA J , et al. Mitochondria-related transcriptional signature is downregulated in adipocytes in obesity: a study of young healthy MZ twins[J]. Diabetologia, 2017, 60 (1): 169- 181.
doi: 10.1007/s00125-016-4121-2 |
25 |
VAN DER KOLK B W , SAARI S , LOVRIC A , et al. Molecular pathways behind acquired obesity: adipose tissue and skeletal muscle multiomics in monozygotic twin pairs discordant for BMI[J]. Cell Rep Med, 2021, 2 (4): 100226.
doi: 10.1016/j.xcrm.2021.100226 |
26 |
SABARATNAM R , HANSEN D R , SVENNINGSEN P . White adipose tissue mitochondrial bioenergetics in metabolic diseases[J]. Rev Endocr Metab Disord, 2023, 24 (6): 1121- 1133.
doi: 10.1007/s11154-023-09827-z |
27 |
IZZO L T , TREFELY S , DEMETRIADOU C , et al. Acetylcarnitine shuttling links mitochondrial metabolism to histone acetylation and lipogenesis[J]. Sci Adv, 2023, 9 (18): eadf0115.
doi: 10.1126/sciadv.adf0115 |
28 |
SHEN Y , WEI W , ZHOU D X . Histone acetylation enzymes coordinate metabolism and gene expression[J]. Trends Plant Sci, 2015, 20 (10): 614- 621.
doi: 10.1016/j.tplants.2015.07.005 |
29 |
LU J Q , TARNOPOLSKY M A . Mitochondrial neuropathy and neurogenic features in mitochondrial myopathy[J]. Mitochondrion, 2021, 56, 52- 61.
doi: 10.1016/j.mito.2020.11.005 |
30 |
MENZIES K J , ZHANG H B , KATSYUBA E , et al. Protein acetylation in metabolism-metabolites and cofactors[J]. Nat Rev Endocrinol, 2016, 12 (1): 43- 60.
doi: 10.1038/nrendo.2015.181 |
31 |
MUNIANDY M , HEINONEN S , YKI-JÄRVINEN H , et al. Gene expression profile of subcutaneous adipose tissue in BMI-discordant monozygotic twin pairs unravels molecular and clinical changes associated with sub-types of obesity[J]. Int J Obes (Lond), 2017, 41 (8): 1176- 1184.
doi: 10.1038/ijo.2017.95 |
32 |
WANG J L , LIN X F , ZHAO N N , et al. Effects of mitochondrial dynamics in the pathophysiology of obesity[J]. Front Biosci (Landmark Ed), 2022, 27 (3): 107.
doi: 10.31083/j.fbl2703107 |
33 |
MENEUX L , FERET N , PERNOT S , et al. Inherited mitochondrial dysfunction triggered by OPA1 mutation impacts the sensory innervation fibre identity, functionality and regenerative potential in the cornea[J]. Sci Rep, 2024, 14 (1): 18794.
doi: 10.1038/s41598-024-68994-4 |
34 |
VON DER MALSBURG A , SAPP G M , ZUCCARO K E , et al. Structural mechanism of mitochondrial membrane remodelling by human OPA1[J]. Nature, 2023, 620 (7976): 1101- 1108.
doi: 10.1038/s41586-023-06441-6 |
35 |
NYENHUIS S B , WU X , STRUB M P , et al. OPA1 helical structures give perspective to mitochondrial dysfunction[J]. Nature, 2023, 620 (7976): 1109- 1116.
doi: 10.1038/s41586-023-06462-1 |
[1] | Shuo YANG, Min HUO, Zixuan SU, Yuxiang SHI. Research Progress on the Impact of Mitochondrial Quality Control on Oxidative Stress in Livestock and Poultry [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(9): 3769-3776. |
[2] | Zijin YUAN, Wanxin WANG, Ya XING, Jiahui LI, Ying XUE, Jing GE, Minmeng ZHAO, Long LIU, Daoqing GONG, Tuoyu GENG. HDLBP Is Involved in Goose Fatty Liver Formation by Regulating the Level of Oxidative Stress and the Expression of Inflammatory Factors [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(9): 3897-3913. |
[3] | Yi WANG, Jianfei GONG, Nuo HENG, Yingfan HU, Rui WANG, Huan WANG, Ni ZHU, Wei HE, Zhihui HU, Haisheng HAO, Huabin ZHU, Shanjiang ZHAO. Melatonin Alleviates Palmitic Acid-induced Damage in Bovine Endometrial Epithelial Cells by Improving Mitochondrial Dynamics [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(9): 3978-3987. |
[4] | Jingxuan WANG, Lizhi DAI, Zhenyu WANG, Ying LIU, Tong YU, Min YAN, Ruilong WANG, Jianhua XIAO. Study on the Characteristics of Liver Energy Metabolism during the Induction of Insulin Resistance by High Fat Diet [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(9): 4172-4185. |
[5] | Ya’nan LI, Tianwen MA, Yuhui MA, Chengwei WEI. Bilobalide Regulates Mitochondrial Biogenesis Mediated by AMPK-SIRT3 Positive Feedback Loop and Improves Inflammatory Damage of ATDC5 Chondrocytes [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(8): 3714-3724. |
[6] | Yaxuan MENG, Yan LIU, Jing WANG, Guoshun CHEN, Tao FENG. Research Progress in the Effect of Oxidative Stress on Ovarian Function in Female Livestock [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(7): 2825-2835. |
[7] | Yuanyuan LI, Tianyu WANG, Meng LI, Wenhui ZHANG, Yinghui WANG, Tianrui ZHAO, Haojie LI, Yangfei ZHAO, Jinming WANG. Selenomethionine, through PINK1/Parkin-mediated Mitochondrial Autophagy, Alleviates Fluoride-induced Depressive-like Behavior [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(7): 3213-3224. |
[8] | Qianling CHEN, Yuzhu SHA, Xiu LIU, Pengyang SHAO, Fanxiong WANG, Xiaowei CHEN, Wenxin YANG, Zhuanhui XIE, Min GAO, Wei HUANG. Research Progress on the Interaction between Gut Microbiota and Mitochondria Regulating Animal Fat Deposition [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2293-2303. |
[9] | Yan ZHANG, Meijin WU, Jiahao ZHOU, Hongxiu DIAO. The Effect of Doxorubicin Treatment on the Differential Expression of lncRNAs in Canine Mammary Tumor CHMp Cell Line [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2716-2726. |
[10] | LI Feifei, ZHANG Chenmiao, TONG Jinjin, JIANG Linshu. Research Progress on the Mechanism of Mitochondrial Autophagy Regulating the Activity of NLRP3 Inflammatory Corpuscles to Improve Animal Health [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(4): 1446-1455. |
[11] | LIU Yangguang, ZHANG Huibin, WEN Haoyu, XIE Fan, ZHAO Shiming, DING Yueyun, ZHENG Xianrui, YIN Zongjun, ZHANG Xiaodong. SNP/Indel Screening Analysis of Porcine Ovarian Granulosa Cells Treated with Follicular Fluid Exosomes [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(2): 576-586. |
[12] | ZHANG Weiyu, CHENG Jing, XU Jiabao, WANG Jing, TAO Xinyan, LI Bo, ZHANG Yawei, ZHANG Dandan, ZHANG Ning, HAO Zhenkai, ZHOU Chenbo, ZHANG Yuanqing. Regulation of Preadipocyte Differentiation by SREBP1 Gene in Jinnan Cattle [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(11): 5003-5017. |
[13] | LU Jian, JU Xiaojun, WANG Xingguo, MA Meng, WANG Qiang, LI Yongfeng, DOU Taocun, HU Yuping, GUO Jun, SHAO Dan, TONG Haibing, QU Liang. Effects of Metabolizable Energy Intake during Rearing on Development of Reproductive Organs, Hormone Level and Gene Expression in Ovary of Laying Hens [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(11): 5085-5100. |
[14] | CAI Menglei, ZHAO Dongxu, ZHANG Zhenggang, LIU Donghai, JIANG Tingting, SU Shixuan, YAN Xuemin, XUE Xiaoyang, CUI Guolin. The Effect of GreA Protein on the Biological Characteristics and Pathogenicity of Salmonella Enteritidis [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(11): 5173-5182. |
[15] | Tingting ZHOU, Li LI, Yantao WU, Wenying LU, Baoquan FU, Hong YIN, Wanzhong JIA, Hongbin YAN. Progress on Single-cell Transcriptomics Technology and Its Applications in Research on Parasites [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(10): 4290-4301. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||