X染色体定点整合GFP元件的野猪诱导多能性干细胞系的建立

doi:10.11843/j.issn.0366-6964.2025.10.021

Abstract

Abstract:

This study aimed to establish induced pluripotent stem cells (iPSCs) of wild boar with stable passage ability, and integrate exogenous genes into the X chromosome of iPSCs, which provides technical support for the conservation, development and utilization of wild boar resources. Eight pluripotency factors were introduced into wild boar fibroblasts by the PiggyBac transposon system to establish the iPSCs line and the pluripotency was identified. Plasmids expressing green fluorescent protein (GFP) were transferred into wild boar iPSCs by electroporation (3 procedures) and chemical transfection reagents lipofectamine 3000 (Lip 3000) and jetPRIME, respectively. And the optimal transfection protocol was screened with analysis of transfection efficiency by flow cytometry. Combined with CRISPR/Cas9 and site-directed integration technology independent of homologous recombination, the sgRNAs with high-efficiency were co-transfected with GFP expression elements into wild boar iPSCs. Then target fragments were amplified by PCR and the site-directed integration of GFP was identified by sequencing. In this study, human OCT4, SOX2, KLF4, C-MYC, NANOG, LIN28, NR5A2 and miR302/367 were introduced into wild boar fibroblasts. Twenty days post-induction, wild boar iPSCs were obtained with normal karyotype, positive alkaline phosphatase staining, stable expression of pluripotency factors OCT4, SOX2 and NANOG. Additionally, embryoid bodies, labeled with three germ layers marker (β Ⅲ tubulin, α-smooth muscle actin and GATA6), were observed in vitro. For different electroporation procedures, the cell transfection efficiency using CG104 ((9.73±0.23)%) was significantly higher than that of CA201 ((7.34±0.03)%) and CB150 ((6.69±0.10)%). The cell transfection efficiency with jetPRIME cationic polymer was (17.9±0.36)%, which was significantly higher than that of Lip 3000 ((14.07±0.85)%). After two plasmids with sgRNA or GFP expression elements were constructed successfully, they were co-transfected into wild boar iPSCs. PCR and sequencing results showed that GFP expression elements were inserted into the predetermined position of X chromosome and could be stably expressed. In conclusion, wild boar iPSCs were derived from fibroblasts. And GFP was knocked into the X chromosome of iPSCs by site-directed integration technology independent of homologous recombination. This study provided technical reference for gene editing in wild boar and breeding of domestic pig.

Key words: wild boar, induced pluripotent stem cells, electroporation, liposomes, site-directed integration of X chromosome

CLC Number:

S828.3

ZHOU Xinyi, YANG Lidan, GAO Chen, WEI Xinhua, HUO Haonan, ZOU Huiying, YU Dawei, DU Weihua. Establishment of Wild Boar Induced Pluripotent Stem Cell Line with X Chromosome-Targeted Integration of GFP Cassette[J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(10): 5007-5017.

Figures/Tables 5

Table 1

Fig. 1

Fig. 2

Fig. 3

Fig. 4

References 39

1	CHOI S K , KIM K S , RANYUK M , et al. Asia-wide phylogeography of wild boar (Sus scrofa) based on mitochondrial DNA and Y-chromosome: Revising the migration routes of wild boar in Asia[J]. PLoS One, 2020, 15 (8): e0238049. doi: 10.1371/journal.pone.0238049
2	ZHANG M P , YANG Q , AI H S , et al. Revisiting the evolutionary history of pigs via de novo mutation rate estimation in a three-generation pedigree[J]. Genomics Proteomics Bioinformatics, 2022, 20 (6): 1040- 1052. doi: 10.1016/j.gpb.2022.02.001
3	KARAMATI S A , EFFATPANAH H , KHODAYARI M T , et al. Global prevalence of Neospora caninum in ddomestic pigs (Sus domesticus) and wild boars (Sus scrofa): a systematic review and meta-analysis[J]. Vet Med Sci, 2025, 11 (1): e70207. doi: 10.1002/vms3.70207
4	LIU Y L , ZHANG S H , ZOU G Y , et al. Generation and characterization of giant panda induced pluripotent stem cells[J]. Sci Adv, 2024, 10 (38): eadn7724. doi: 10.1126/sciadv.adn7724
5	WU Y R , WANG C W , FAN X Y , et al. The impact of induced pluripotent stem cells in animal conservation[J]. Vet Res Commun, 2024, 48 (2): 649- 663. doi: 10.1007/s11259-024-10294-3
6	TAKAHASHI K , YAMANAKA S . Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors[J]. Cell, 2006, 126 (4): 663- 676. doi: 10.1016/j.cell.2006.07.024
7	YAMANAKA S . Pluripotent stem cell-based cell therapy-promise and challenges[J]. Cell Stem Cell, 2020, 27 (4): 523- 531. doi: 10.1016/j.stem.2020.09.014
8	ZHANG Z W , BAO X Y , LIN C P . Progress and prospects of gene editing in pluripotent stem cells[J]. Biomedicines, 2023, 11 (8): 2168. doi: 10.3390/biomedicines11082168
9	ZHU G X , GAO D F , LI L Z , et al. Generation of three-dimensional meat-like tissue from stable pig epiblast stem cells[J]. Nat Commun, 2023, 14 (1): 8163. doi: 10.1038/s41467-023-44001-8
10	PACESA M , PELEA O , JINEK M . Past, present, and future of CRISPR genome editing technologies[J]. Cell, 2024, 187 (5): 1076- 1100. doi: 10.1016/j.cell.2024.01.042
11	KIM T K , EBERWINE J H . Mammalian cell transfection: the present and the future[J]. Anal Bioanal Chem, 2010, 397 (8): 3173- 3178. doi: 10.1007/s00216-010-3821-6
12	FUS-KUJAWA A , PRUS P , BAJDAK-RUSINEK K , et al. An overview of methods and tools for transfection of eukaryotic cells in vitro[J]. Front Bioeng Biotechnol, 2021, 9, 701031. doi: 10.3389/fbioe.2021.701031
13	HAHN P , SCANLAN E . Gene delivery into mammalian cells: an overview on existing approaches employed in vitro and in vivo[J]. Top Curr Chem, 2010, 296, 1- 13.
14	NASO M F , TOMKOWICZ B , PERRY W R , et al. Adeno-associated virus (AAV) as a vector for gene therapy[J]. BioDrugs, 2017, 31 (4): 317- 334. doi: 10.1007/s40259-017-0234-5
15	RAHIMI P , MOBARAKEH V I , KAMALZARE S , et al. Comparison of transfection efficiency of polymer-based and lipid-based transfection reagents[J]. Bratisl Lek Listy, 2018, 119 (11): 701- 705.
16	MIDOUX P , PICHON C , AOUANC J J , et al. Chemical vectors for gene delivery: a current review on polymers, peptides and lipids containing histidine or imidazole as nucleic acids carriers[J]. Br J Pharmacol, 2009, 157 (2): 166- 178. doi: 10.1111/j.1476-5381.2009.00288.x
17	LEAL A F , HERRENO-PACHON A M , BENINCORE-FLOREZ E , et al. Current strategies for increasing knock-in efficiency in CRISPR/Cas9-based approaches[J]. Int J Mol Sci, 2024, 25 (5): 2456. doi: 10.3390/ijms25052456
18	SUZUKI K , IZPISUA BELMONTE J C . In vivo genome editing via the HITI method as a tool for gene therapy[J]. J Hum Genet, 2018, 63 (2): 157- 164. doi: 10.1038/s10038-017-0352-4
19	FEBBRARO F , CHEN M , DENHAM M . Generation of human iPSCs by episomal reprogramming of skin fibroblasts and peripheral blood mononuclear cells[J]. Methods Mol Biol, 2021, 2239, 135- 151.
20	WANG J L , SUN S C , DENG H K . Chemical reprogramming for cell fate manipulation: methods, applications, and perspectives[J]. Cell Stem Cell, 2023, 30 (9): 1130- 1147. doi: 10.1016/j.stem.2023.08.001
21	ZHU Q Q , WANG F C , GAO D F , et al. Generation of stable integration-free pig induced pluripotent stem cells under chemically defined culture condition[J]. Cell Prolif, 2023, 56 (11): e13487. doi: 10.1111/cpr.13487
22	BATISTA N T , POLAJZER T , MIKLAVCIC D . Cell death due to electroporation - a review[J]. Bioelectrochemistry, 2021, 141, 107871. doi: 10.1016/j.bioelechem.2021.107871
23	HAMADA T , YOKOYAMA S , AKAHANE T , et al. Electroporation induces unexpected alterations in gene expression: a tip for selection of optimal transfection method[J]. Curr Issues Mol Biol, 2025, 47 (2): 91. doi: 10.3390/cimb47020091
24	PAVLOV R V , AKIMOV S A , DASHINIMAEV E B , et al. Boosting lipofection efficiency through enhanced membrane fusion mechanisms[J]. Int J Mol Sci, 2024, 25 (24): 13540. doi: 10.3390/ijms252413540
25	CUESTA-GOMEZ N , VERHOEFF K , DADHEECH N , et al. Suspension culture improves iPSCs expansion and pluripotency phenotype[J]. Stem Cell Res Ther, 2023, 14 (1): 154. doi: 10.1186/s13287-023-03382-9
26	胡暄, 王松, 于璐, 等. Cas9/sgRNA递送技术及其研究进展[J]. 生物工程学报, 2021, 37 (11): 3880- 3889.
	HU X , WANG S , YU L , et al. Advances of Cas9/sgRNA delivery system for gene editing[J]. Chinese Journal of Biotechnology, 2021, 37 (11): 3880- 3889.
27	NAHAR S , SEHGAL P , AZHAR M , et al. A G-quadruplex motif at the 3' end of sgRNAs improves CRISPR-Cas9 based genome editing efficiency[J]. Chem Commun (Camb), 2018, 54 (19): 2377- 2380. doi: 10.1039/C7CC08893K
28	HEIDERSBACH A J , DORIGHI K M , GOMEZ J A , et al. A versatile, high-efficiency platform for CRISPR-based gene activation[J]. Nat Commun, 2023, 14 (1): 902. doi: 10.1038/s41467-023-36452-w
29	GUO C T , MA X T , GAO F , et al. Off-target effects in CRISPR/Cas9 gene editing[J]. Front Bioeng Biotechnol, 2023, 11, 1143157. doi: 10.3389/fbioe.2023.1143157
30	JIN Y , HAN G C , GAO Y M , et al. Serum-tolerant polymeric complex for stem-cell transfection and neural differentiation[J]. Nat Commun, 2025, 16 (1): 2022. doi: 10.1038/s41467-025-57278-8
31	CHEN Q C , CHUAI G H , ZHANG H H , et al. Genome-wide CRISPR off-target prediction and optimization using RNA-DNA interaction fingerprints[J]. Nat Commun, 2023, 14 (1): 7521. doi: 10.1038/s41467-023-42695-4
32	BALKE-WANT H , KEERTHI V , GKITSAS N , et al. Homology-independent targeted insertion (HITI) enables guided CAR knock-in and efficient clinical scale CAR-T cell manufacturing[J]. Mol Cancer, 2023, 22 (1): 100. doi: 10.1186/s12943-023-01799-7
33	LU H X , LIU J , FENG T , et al. A HIT-trapping strategy for rapid generation of reversible and conditional alleles using a universal donor[J]. Genome Res, 2021, 31 (5): 900- 909. doi: 10.1101/gr.271312.120
34	YAMAMOTO Y , GERBI S A . Making ends meet: targeted integration of DNA fragments by genome editing[J]. Chromosoma, 2018, 127 (4): 405- 420. doi: 10.1007/s00412-018-0677-6
35	MENG X , JIA R X , ZHAO X P , et al. In vivo genome editing via CRISPR/Cas9-mediated homology- independent targeted integration for Bietti crystalline corneoretinal dystrophy treatment[J]. Nat Commun, 2024, 15 (1): 3773. doi: 10.1038/s41467-024-48092-9
36	KAWAMATA M , SUZUKI H I , KIMURA R , et al. Optimization of Cas9 activity through the addition of cytosine extensions to single-guide RNAs[J]. Nat Biomed Eng, 2023, 7 (5): 672- 691. doi: 10.1038/s41551-023-01011-7
37	ZHANG M F , YI F , WU J J , et al. The efficient generation of knockout microglia cells using a dual-sgRNA strategy by CRISPR/Cas9[J]. Front Mol Neurosci, 2022, 15, 1008827. doi: 10.3389/fnmol.2022.1008827
38	VAKULSKAS C A , DEVER D P , RETTIG G R , et al. A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells[J]. Nat Med, 2018, 24 (8): 1216- 1224. doi: 10.1038/s41591-018-0137-0
39	BRAVO J P K , LIU M S , HIBSHMAN G N , et al. Structural basis for mismatch surveillance by CRISPR-Cas9[J]. Nature, 2022, 603 (7900): 343- 347. doi: 10.1038/s41586-022-04470-1

引物名称 Primer name	引物序列(5′→3′) Primers sequence
HIT-EF1α-GFP-F	GACACTATAGAACTCGACCACTAGTTTTGAGATCGAGTGCCGCATCACGGGCTCGAG-
	TCGTCGTGAGGCTCCGGTGCCCG
HIT-EF1α-GFP-R	GGCACTCGATCTCAAAGGCCGGCGCGCCTAAGATACATTG
PH-I-sgRNA1-F	CACCGTTGAACTCATGCGGAAAGGG
PH-I-sgRNA1-R	AAACCCCTTTCCGCATGAGTTCAAC
PH-I-sgRNA2-F	CACCGGCACACTCAGGGTCCAGTA
PH-I-sgRNA2-R	AAACTACTGGACCCTGAGTGTGCC
PH-I-F	GAGGACCAAATTCTCACTTCAAC
PH-I-R	TAGGGGTCAAATCAGAGCTACAG
EF1α-R	TAGGCACCGGTTCAATTGCCGA

[1]	YANG Shubo, YUAN Qingxin, CHEN Qibai, WANG Pei, GAO Dongyang, LI He, SONG Jun. Preparation and Intracellular Antibacterial Activity of Liposomes Encapsulating Staphylococcus aureus Bacteriophage [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(9): 4638-4645.
[2]	TAN Juanjuan, YANG Beiying, WU Qianyue, HUA Huiying, CAO Huabin, YAN Hui, ZHANG Jinhua. Diversity Analysis of Wild Boar Flora in Jiangxi Region and the Isolation and Identification of Clostridium perfringens Carried by Wild Boar [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(4): 1876-1886.
[3]	ZHAO Wenxuan, GAO Xue, YU Dawei, GAO Chen, LI Junya. Establishment and Pluripotency Analysis of Induced Pluripotent Stem Cells from Mengshan Cattle [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(4): 1731-1743.
[4]	WANG Jiamei, HUANG Yongzhen, GAO Chen, LI Junliang, CHEN Yan, ZHU Bo, ZHANG Lupei, WANG Zezhao, GAO Huijiang, LI Junya, GAO Xue. Research Progress and Overview on Pluripotent Stem Cells in Livestock [J]. Acta Veterinaria et Zootechnica Sinica, 2025, 56(4): 1473-1483.
[5]	WANG Hui, XU Mengyuan, LIU Lingkang, ZHENG Xibang, LI Gonghe, WU Wende. PhiC31 Integrase Triggers Site-specific Cassette Exchange in Chicken Fibroblast Cells through Electroporation [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(6): 2330-2342.
[6]	LUO Ruijie, CAO Suying. Research Progress and Application Prospect of Livestock Pluripotent Stem Cells [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(10): 4003-4015.
[7]	ZHANG Wei, ZHANG Shao-peng, LI En-hong, CAO An, LIU Zhi-yu, HAN Jian-yong, CAO Su-ying. Porcine Extraembryonic Endoderm Stem Cell like Cells Induced by Overexpression of Gata6 [J]. ACTA VETERINARIA ET ZOOTECHNICA SINICA, 2017, 48(12): 2314-2322.
[8]	ZHANG Haibin;ZHOU Mingdong;ZHOU Xia;HU Jingdong;ZHAO Hongkun; . Effect of Mature Chicken Interleukin-18 Protein on Its Immunoenhancement on Newcastle Disease Vaccine [J]. ACTA VETERINARIA ET ZOOTECHNICA SINICA, 2012, 43(8): 1287-1291.
[9]	LI Zhong-qiu, LIU Chun-long, MA Hong, FU Bo, WANG Liang, PENG Fu-gang, MA Jian-zhang, LIU Di. Influence of Cold Stress on Transcription of HSP90 in Northeast Wild Boar Fibroblasts [J]. ACTA VETERINARIA ET ZOOTECHNICA SINICA, 2012, 43(12): 1978-1983.
[10]	DU Shan;MA Baohua;LI Liangliang;LIU Jun;ZHAO Xiaoe;ZHANG Yong . Optimization of Electroporation for Transfection of Goat Mammary Epithelial Cells [J]. ACTA VETERINARIA ET ZOOTECHNICA SINICA, 2012, 43(1): 159-166.
[11]	SONG Yong-li;HE Xiao-ning;HUA Song;LAN Jie;ZHENG Yue-mao;HE Xiao-ying;LI Ji-xia;QUAN Fu-sheng;ZHANG Yong . Culture of Bovine Fetal Skin Fibroblasts in vitro and Ipr1 Gene Transfection [J]. ACTA VETERINARIA ET ZOOTECHNICA SINICA, 2011, 42(4): 585-592.
[12]	LIU Li-hua;MIN Ling-jiang;SHEN Wei;PAN Qing-jie. Analysis of Genetic Structure in Wild Boar and Their Crossbred Populations [J]. ACTA VETERINARIA ET ZOOTECHNICA SINICA, 2009, 40(2): 173-179.
[13]	YANG Xiuqin;GUAN Qingzhi;YU Hao;GUO Lijuan;LIU Hui;LIU Di;. Cloning, Sequence Analysis and Expression of Two Transcript Variants of Wild Boar CAPN10 Gene [J]. ACTA VETERINARIA ET ZOOTECHNICA SINICA, 2009, 40(11): 0-1614.
[14]	BAO Wenbin;WU Shenglong;CAO Jingjing;JU Huiping;ZHU Guoqiang;CHEN Guohong . <A href= [J]. ACTA VETERINARIA ET ZOOTECHNICA SINICA, 2009, 40(10): 0-1554.
[15]	LI Xiao-lin;PAN Qing-jie;MIN Ling-jiang;SHEN Wei;LIU Di. Genetic Co-adaptability of Structural Genes in Wild Boars Populations [J]. ACTA VETERINARIA ET ZOOTECHNICA SINICA, 2008, 39(3): 262-267.

Establishment of Wild Boar Induced Pluripotent Stem Cell Line with X Chromosome-Targeted Integration of GFP Cassette

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 5

References 39

Related Articles 15

Recommended Articles

Metrics

Comments