FKBP5基因对绵羊卵泡颗粒细胞功能的影响

doi:10.11843/j.issn.0366-6964.2024.09.019

Abstract

Abstract:

This study aimed to investigate the potential function of FKBP5 in ovine ovarian granulosa cells (GCs). GCs were isolated from the ovaries of twenty approximately 2-year-old sexually mature Altay sheep obtained from the Hualing slaughterhouse in Urumqi. The experiment was divided into 4 groups: GC (blank control), GC+NC (transfected with siRNA-NC), GC+siFKBP5 (transfected with siRNA-FKBP5), and GC+siFKBP5+LH (treated with luteinizing hormone and transfected with siRNA-FKBP5). Immunofluorescence was used to detect the localization of FKBP5 protein in GCs. Its effects on cell proliferation and apoptosis were examined using EdU, Tunel assays, and Western Blot analysis. Its impacts on the AKT and ERK signaling pathways were assessed by Western blot, while the levels of E2 and P4 were measured by ELISA. FKBP5 was found to be expressed in the cytoplasm of GCs. Its expression increased with the increasing concentration of LH, reaching a peak at 5 IU·mL^-1 LH after 4 h of treatment (P < 0.001). Knockdown of FKBP5 significantly inhibited cell proliferation, as evidenced by a reduction in PCNA protein expression (P < 0.001). It also significantly promoted cell apoptosis, with an increase in BAX expression and a decrease in Bcl-2 expression (P < 0.001). Additionally, FKBP5 knockdown markedly suppressed the activation of the AKT and ERK signaling pathways and the secretion of E2 and P4 (P < 0.001). LH treatment partially mitigated the effects of FKBP5 knockdown on GCs (P < 0.05). The results indicate that FKBP5 influences the proliferation and apoptosis of ovine GCs, as well as the activation of the AKT and ERK signaling pathways and the secretion of E2 and P4. Its function is modulated by LH. These findings provide a theoretical basis for further research on the role of FKBP5 in ovine follicular development.

Key words: FKBP5, granulosa cells, cell proliferation and apoptosis, AKT and ERK signaling pathways, steroids

CLC Number:

S826.2

古丽米热·阿布都热依木, Xinru ZHANG, Yangsheng WU, Ying CHEN, Liqin WANG, Xinming XU, Juncheng HUANG, Jiapeng LIN. Effects of FKBP5 on Function of Sheep Follicular Granulosa Cells[J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(9): 3947-3956.

Figures/Tables 7

Table 1

Table 2

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

References 40

1	KOSSOWSKA-TOMASZCZUK K , DE GEYTER C , DE GEYTER M , et al. The multipotency of luteinizing granulosa cells collected from mature ovarian follicles[J]. Stem cells, 2009, 27 (1): 210- 219. doi: 10.1634/stemcells.2008-0233
2	ZHANG C H , LIU X Y , WANG J . Essential role of granulosa cell glucose and lipid metabolism on oocytes and the potential metabolic imbalance in polycystic ovary syndrome[J]. Int J Mol Sci, 2023, 24 (22): 16247. doi: 10.3390/ijms242216247
3	HÄHLE A , MERZ S , MEYNERS C , et al. The many faces of FKBP51[J]. Biomolecules, 2019, 9 (1): 35. doi: 10.3390/biom9010035
4	ZIMMER C , JIMENO B , MARTIN L B . HPA flexibility and FKBP5:promising physiological targets for conservation[J]. Philos Trans R Soc Lond B Biol Sci, 2024, 379 (1898): 20220512. doi: 10.1098/rstb.2022.0512
5	MARRONE L, D'AGOSTINO M, CESARO E, et al. Alternative splicing of FKBP5 gene exerts control over T lymphocyte expansion[J/OL]. J Cell Biochem, 2023. https://doi.org/10.1002/jcb.30364.
6	BINDER E B . The role of FKBP5, a co-chaperone of the glucocorticoid receptor in the pathogenesis and therapy of affective and anxiety disorders[J]. Psychoneuroendocrinology, 2009, 34 (S1): S186- S195.
7	SABBAGH J J , CORDOVA R A , ZHENG D L , et al. Targeting the FKBP51/GR/Hsp90 complex to identify functionally relevant treatments for depression and PTSD[J]. ACS Chem Biol, 2018, 13 (8): 2288- 2299. doi: 10.1021/acschembio.8b00454
8	WANG L S , WOJCIESZAK J , KUMAR R , et al. FKBP51-Hsp90 interaction-deficient mice exhibit altered endocrine stress response and sex differences under high-fat diet[J]. Mol Neurobiol, 2024, 61 (3): 1479- 1494. doi: 10.1007/s12035-023-03627-x
9	LI L , LOU Z , WANG L . The role of FKBP5 in cancer aetiology and chemoresistance[J]. Br J Cancer, 2011, 104 (1): 19- 23. doi: 10.1038/sj.bjc.6606014
10	PÉREZ-PÉREZ B , CRISTÓBAL-NARVÁEZ P , SHEINBAUM T , et al. Interaction between FKBP5 variability and recent life events in the anxiety spectrum: Evidence for the differential susceptibility model[J]. PLoS One, 2018, 13 (2): e0193044. doi: 10.1371/journal.pone.0193044
11	YIN H L , GALFALVY H , PANTAZATOS S P , et al. Glucocorticoid receptor-related genes: genotype and brain gene expression relationships to suicide and major depressive disorder.depress anxiety[J]. Depress Anxiety, 2016, 33 (6): 531- 540. doi: 10.1002/da.22499
12	CRIADO-MARRERO M , SMITH T M , GOULD L A , et al. FKBP5 and early life stress affect the hippocampus by an age-dependent mechanism[J]. Brain Behav Immun Health, 2020, 9, 100143. doi: 10.1016/j.bbih.2020.100143
13	ZHANG Y , YUE W H , LI J . The association of FKBP5 gene polymorphism with genetic susceptibility to depression and response to antidepressant treatment-a systematic review[J]. BMC Psychiatry, 2024, 24 (1): 274. doi: 10.1186/s12888-024-05717-z
14	LOU Q Y , LI Z , TENG Y , et al. Associations of FKBP4 and FKBP5 gene polymorphisms with disease susceptibility, glucocorticoid efficacy, anxiety, depression, and health-related quality of life in systemic lupus erythematosus patients[J]. Clin Rheumatol, 2021, 40 (1): 167- 179. doi: 10.1007/s10067-020-05195-0
15	MA X Y , WANG Z , ZHANG C M , et al. Association of SNPs in the FK-506 binding protein (FKBP5) gene among Han Chinese women with polycystic ovary syndrome[J]. BMC Med Genomics, 2022, 15 (1): 149. doi: 10.1186/s12920-022-01301-0
16	CHEN F , CHEN Z R , CHEN M J , et al. Reduced stress-associated FKBP5 DNA methylation together with gut microbiota dysbiosis is linked with the progression of obese PCOS patients[J]. NPJ Biofilms Microbiomes, 2021, 7 (1): 60. doi: 10.1038/s41522-021-00231-6
17	TARRYN W , AMBERLY O , STEPHANIE D , et al. A pilot investigation of genetic and epigenetic variation of FKBP5 and response to exercise intervention in African women with obesity[J]. Sci Rep, 2022, 12 (1): 11771. doi: 10.1038/s41598-022-15678-6
18	HÄUSL A S , BALSEVICH G , GASSEN N C , et al. Focus on FKBP51:A molecular link between stress and metabolic disorders[J]. Mol Metab, 2019, 29, 170- 181. doi: 10.1016/j.molmet.2019.09.003
19	AGAM G , ATAWNA B , DAMRI O , et al. The role of FKBPs in complex disorders: neuropsychiatric diseases, cancer, and type 2 diabetes mellitus[J]. Cells, 2024, 13 (10): 801. doi: 10.3390/cells13100801
20	HU Z G , GE L Y , ZHANG H L , et al. Expression of FKBP prolyl isomerase 5 gene in tissues of muscovy duck at different growth stages and its association with muscovy duck weight[J]. Anim Biosci, 2022, 35 (1): 1- 12. doi: 10.5713/ab.20.0649
21	SUN Y F , LI C J , SUN Y L , et al. Expression of neurotrophin 4 and its receptor tyrosine kinase B in reproductive tissues during the follicular and luteal phases in cows[J]. Asian-Australas J AnimSci, 2011, 24 (3): 336- 343. doi: 10.5713/ajas.2011.10251
22	DOS SANTOS E C , BOYER A , ST-JEAN G , et al. Is the hippo pathway effector yes-associated protein a potential key player of dairy cattle cystic ovarian disease pathogenesis?[J]. Animals, 2023, 13 (18): 2851. doi: 10.3390/ani13182851
23	ZHU L , JING J , QIN S Q , et al. miR-99a-5p inhibits target gene FZD5 expression and steroid hormone secretion from goat ovarian granulosa cells[J]. J Integr Agric, 2022, 21 (4): 1137- 1145. doi: 10.1016/S2095-3119(21)63766-8
24	CHEN S , GUO X F , HE X Y , et al. Insight into pituitary lncRNA and mRNA at two estrous stages in small tail Han sheep with different FecB genotypes[J]. Front Endocrinol (Lausanne), 2022, 12, 789564. doi: 10.3389/fendo.2021.789564
25	WANG C X , ZHAO Y H , YUAN Z Y , et al. Genome-wide identification of mRNAs, lncRNAs, and proteins, and their relationship with sheep fecundity[J]. Front Genet, 2022, 12, 750947. doi: 10.3389/fgene.2021.750947
26	SILVA B D M , CASTRO E A , SOUZA C J H , et al. A new polymorphism in the Growth and Differentiation Factor 9 (GDF9) gene is associated with increased ovulation rate and prolificacy in homozygous sheep[J]. Anim Genet, 2011, 42 (1): 89- 92. doi: 10.1111/j.1365-2052.2010.02078.x
27	JEON H , CHOI Y , BRÄNNSTRÖM M , et al. Cortisol/glucocorticoid receptor: a critical mediator of the ovulatory process and luteinization in human periovulatory follicles[J]. Hum Reprod, 2023, 38 (4): 671- 685. doi: 10.1093/humrep/dead017
28	HORI H , YOSHIDA F , ISHIDA I , et al. Blood mRNA expression levels of glucocorticoid receptors and FKBP5 are associated with depressive disorder and altered HPA axis[J]. J Affect Disord, 2024, 349, 244- 253. doi: 10.1016/j.jad.2024.01.080
29	RIZAVI H S , KHAN O S , ZHANG H , et al. Methylation and expression of glucocorticoid receptor exon-1 variants and FKBP5 in teenage suicide-completers[J]. Transl Psychiatry, 2023, 13 (1): 53. doi: 10.1038/s41398-023-02345-1
30	GUPTA C , CHAPEKAR T , CHHABRA Y , et al. Differential response to sustained stimulation by hCG & LH on goat ovarian granulosa cells[J]. Indian J Med Res, 2012, 135 (3): 331- 340.
31	RICHARDS J S , PANGAS S A . The ovary: basic biology and clinical implications[J]. J Clin Invest, 2010, 120 (4): 963- 972. doi: 10.1172/JCI41350
32	MA X F , LIU A J , TIAN S J . A meta-analysis of mRNA expression profiling studies in sheep with different FecB genotypes[J]. Anim Genet, 2023, 54 (3): 225- 238. doi: 10.1111/age.13304
33	CAMERON M R , FOSTER J S , BUKOVSKY A , et al. Activation of mitogen-activated protein kinases by gonadotropins and cyclic adenosine 5′-monophosphates in porcine granulosa cells[J]. Biol Reprod, 1996, 55 (1): 111- 119. doi: 10.1095/biolreprod55.1.111
34	CARVALHO C R O , CARVALHEIRA J B C , LIMA M H M , et al. Novel signal transduction pathway for luteinizing hormone and its interaction with insulin: activation of Janus kinase/signal transducer and activator of transcription and phosphoinositol 3-kinase/Akt pathways[J]. Endocrinology, 2003, 144 (2): 638- 647. doi: 10.1210/en.2002-220706
35	PAN B , ZHAN X S , LI J L . MicroRNA-574 impacts granulosa cell estradiol production via targeting TIMP3 and ERK1/2 signaling pathway[J]. Front Endocrinol (Lausanne), 2022, 13, 852127. doi: 10.3389/fendo.2022.852127
36	BADDELA V S , MICHAELIS M , TAO X L , et al. ERK1/2-SOX9/FOXL2 axis regulates ovarian steroidogenesis and favors the follicular-luteal transition[J]. Life Sci Alliance, 2023, 6 (10): e202302100. doi: 10.26508/lsa.202302100
37	SALEHI R , WYSE B A , ASARE-WEREHENE M , et al. Androgen-induced exosomal miR-379-5p release determines granulosa cell fate: cellular mechanism involved in polycystic ovaries[J]. J Ovarian Res, 2023, 16 (1): 74. doi: 10.1186/s13048-023-01141-1
38	ZHENG X , CHEN L , CHEN T , et al. The mechanisms of BDNF promoting the proliferation of porcine follicular granulosa cells: role of miR-127 and involvement of the MAPK-ERK1/2 pathway[J]. Animals (Basel), 2023, 13 (6): 1115.
39	RUGG M S , WILLIS A C , MUKHOPADHYAY D , et al. Characterization of complexes formed between TSG-6 and inter-α-inhibitor that act as intermediates in the covalent transfer of heavy chains onto hyaluronan[J]. J Biol Chem, 2005, 280 (27): 25674- 25686. doi: 10.1074/jbc.M501332200
40	BAO B , GARVERICK H A . Expression of steroidogenic enzyme and gonadotropin receptor genes in bovine follicles during ovarian follicular waves: a review[J]. J Anim Sci, 1998, 76 (7): 1903- 1921. doi: 10.2527/1998.7671903x

si-RNA名称 si-RNA name	引物序列(5′→3′) Primers sequence
si-NC	S：UUCUCCGAACGUGUCACGUTT AS：CGUGACACGUUCGGAGAATT
si-416	S：GUCCAUUACAGAGGGAAAUTT AS：AUUUCCCUCUGUAAUGGACTT
si-1023	S：GGGAGAUGGAUACCAAAGATT AS：UCUUUGGUAUCCAUCUCCCTT
si-1523	S：GAGGCCAGUAAAGCAAUGATT AS：UCAUUGCUUUACUGGCCUCTT

基因名称 Gene name	引物序列(5′→3′) Primer sequence	产物大小/bp Product size	退火温度/℃ Temperature
FKBP5	F: CAGTCTCCCCAAAATTCCCTC R: ATCAAACATCCTTCCACCACA	196	58
β-actin	F: TGACCCAGATCATGTTTGAGA R: CAAGGTCCAGACGCAGGAT	186	58

[1]	Haoran SONG, Xiaoyi FENG, Peipei ZHANG, Hang ZHANG, Yifan NIU, Zhou YU, Pengcheng WAN, Kai CUI, Xueming ZHAO. The Mechanism of Follicular Granulosa Cells in Follicular Development in Dairy Cows [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2313-2324.
[2]	LÜ Shiqi, ZHOU Rongyan, TIAN Shujun, CHEN Xiaoyong. Study on the Physiological Mechanism of Mitochondrial tRNA-Lys(T7719G) Gene Variation Affecting Apoptosis of Ovine Granulosa Cell [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(5): 2011-2021.
[3]	PIAN Huifang, DU Xubin, LI Yan, ZHANG Yuchen, HE Hui, YU Debing. Effects of Betaine on Performance, Egg Quality and Antioxidant Capacity of Late-phase Laying Hens [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(3): 1085-1094.
[4]	LIU Yangguang, ZHANG Huibin, WEN Haoyu, XIE Fan, ZHAO Shiming, DING Yueyun, ZHENG Xianrui, YIN Zongjun, ZHANG Xiaodong. SNP/Indel Screening Analysis of Porcine Ovarian Granulosa Cells Treated with Follicular Fluid Exosomes [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(2): 576-586.
[5]	SHI Shengjie, WANG Liguang, GAO Lei, CAI Chuanjiang, HE Weixian, CHU Guiyan. Effect of miR-24-3p on Estradiol Synthesis in Porcine Granulosa Cells [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(1): 169-178.
[6]	DUAN Xiangru, KANG Jia, YANG Ruochen, SHAN Xinyu, LI Taichun, ZHAO Wen, ZHANG Yingjie, LIU Yueqin. Effect of L-cysteine on Proliferation, Apoptosis and the Secretion of Steroid Hormone in Ovine Ovarian Granulosa Cells [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(1): 179-191.
[7]	HE Mingyang, MA Yujing, WANG Yong, YANG Ruochen, LIU Yueqin, ZHANG Yingjie, DUAN Chunhui. Effects of Melatonin on Proliferation, Apoptosis of Ovarian Granulosa Cells, and Its Secretion of Steroid Hormones of Sheep [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(8): 3313-3324.
[8]	LIU Jie, XU Xiangping, DENG Ming, ZOU Xian, JIANG Shengwei, LIU Dewu, LIU Guangbin, SUN Baoli, GUO Yongqing, LI Yaokun. Effect of miR-144-5p Targeting WNT5a on the Proliferation and Apoptosis of Goat Ovarian Granulosa Cells [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(6): 2421-2435.
[9]	HU Yamei, SONG Xiangrong, HUANG Liang, ZHANG Lutong, GAO Lei, PANG Weijun, YANG Gongshe, CHU Guiyan. FGF21 Enhances Mitochondrial Function and Inhibits Apoptosis of Porcine Ovarian Granulosa Cells [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(3): 1034-1045.
[10]	MENG Zhaoyi, WANG Yunlu, XU Yefen, NIU Jiaqiang, SUOLANG Sizhu, GUO Min, XI Guangyin. Construction of Yak lncRNA ENSBGRT00000000387.1 Lentivirus Vector and Its Effect on Apoptosis of Yak Follicular Granulosa Cells [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(3): 1058-1070.
[11]	SONG Pengyan, WANG Siwei, YUE Qiaoxian, ZHANG Yinliang, CHEN Xiaoyong, ZHOU Rongyan. Identification of oar-miR-200b Promoter and Effects on Mitochondrial Function in Follicular Granulosa Cells [J]. Acta Veterinaria et Zootechnica Sinica, 2023, 54(12): 5066-5076.
[12]	WEI Jiayuan, ZHU Qian, YANG Yaxing, SHEN Ming. Inhibition of Porcine Follicular Granulosa Cell Proliferation by Cobalt Chloride Induced DNA Oxidative Damage [J]. Acta Veterinaria et Zootechnica Sinica, 2022, 53(9): 2982-2992.
[13]	TANG Ziwen, CHENG Huaqin, LIU Dongju, PHAGMO Droma, YANG Xue, LI Jian, YIN Shi. The Protective Effect of Proanthocyanidins on Oxidative Damage of Yak Granulosa Cells Induced by Zearalenone [J]. Acta Veterinaria et Zootechnica Sinica, 2022, 53(9): 3006-3017.
[14]	WANG Lei, HE Lina, TANG Xue, LI Bijun, HUANG Siyi, WANG Yukun, XU Dejun, ZHAO Zhongquan. Effects of miR-495-3p on Ovarian Granulosa Cell Functions in Goat [J]. Acta Veterinaria et Zootechnica Sinica, 2022, 53(2): 436-446.
[15]	FU Qiang, YUE Qiaoxian, XI Jianzhong, SONG Pengyan, CHEN Xiaoyong, ZHOU Rongyan. Effect of Oar-miR-127/FOXO4 Feedback Loop on Genes Associated with Apoptosis of Sheep Granulosa Cells [J]. Acta Veterinaria et Zootechnica Sinica, 2022, 53(1): 66-75.

Effects of FKBP5 on Function of Sheep Follicular Granulosa Cells

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 7

References 40

Related Articles 15

Recommended Articles

Metrics

Comments