Acta Veterinaria et Zootechnica Sinica ›› 2024, Vol. 55 ›› Issue (9): 3853-3863.doi: 10.11843/j.issn.0366-6964.2024.09.011
• Animal Genetics and Breeding • Previous Articles Next Articles
Nanzhu CHEN(), Junliang LI, Dawei YU, Xinyi ZHOU, Jing WANG, Huiying ZOU*(
), Weihua DU*(
)
Received:
2024-02-21
Online:
2024-09-23
Published:
2024-09-27
Contact:
Huiying ZOU, Weihua DU
E-mail:nzc1417@163.com;zouhuiying@caas.cn;duweihua@caas.cn
CLC Number:
Nanzhu CHEN, Junliang LI, Dawei YU, Xinyi ZHOU, Jing WANG, Huiying ZOU, Weihua DU. Analysis of Imprinted Expression and DNA Methylation Status of the Porcine MKRN3 Gene[J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(9): 3853-3863.
Table 1
Primers information"
引物名称 Primer name | 引物序列(5′→3′) Primer sequence | 退火温度/℃ Tm | 用途 Application | 片段长度/bp Length |
esm-MKRN3-snp1F | CAGTGTCGGAAGGAACAATGGA | 58 | SNP检测 | 1 131 |
esm-MKRN3-snp1R | ACGAAAGCATTGCCCCATGATA | |||
esm-MKRN3-snp2F | GGAGCATGCCATTGAGTTTGTTC | 59 | SNP检测 | 1 067 |
esm-MKRN3-snp2R | GGATGTTTTGTGACTTTTTAGCACAGTG | |||
esm-MKRN3-snp3F | AGAAGCTGCTGAAACCATTTGT | 58 | SNP检测 | 929 |
esm-MKRN3-snp3R | CAAAGAATGTGTATCTGAGTCCAGG | |||
cDNA-SNP1F | CTGTCGATACTCCCATGACCT | 58 | MKRN3表达 | 169 |
cDNA-SNP1R | CAGAGGAAAAGAGCGTGAGGA | |||
MKRN3-WF1 | GTTAGTAGGGAAAGTTAGGA | 50 | DMR甲基化 | 692 |
MKRN3-WR1 | AAATAAACCAAAACTTAATCTCC | |||
MKRN3-NF1 | GATATAAAATGGAGTGAATAAATAAAG | 55 | DMR甲基化 | 465 |
MKRN3-NR1 | TCCATAACAACTTCTACTCCCC |
1 |
LIAO J , SONG S M , GUSSCOTT S , et al. Establishment of paternal methylation imprint at the H19/Igf2 imprinting control region[J]. Sci Adv, 2023, 9 (36): eadi2050.
doi: 10.1126/sciadv.adi2050 |
2 |
PLASSCHAERT R N , BARTOLOMEI M S . Genomic imprinting in development, growth, behavior and stem cells[J]. Development, 2014, 141 (9): 1805- 1813.
doi: 10.1242/dev.101428 |
3 |
CARRION S A , MICHAL J J , JIANG Z H . Imprinted genes: genomic conservation, transcriptomic dynamics and phenomic significance in health and diseases[J]. Int J Biol Sci, 2023, 19 (10): 3128- 3142.
doi: 10.7150/ijbs.83712 |
4 |
MONK D , MACKAY D J G , EGGERMANN T , et al. Genomic imprinting disorders: lessons on how genome, epigenome and environment interact[J]. Nat Rev Genet, 2019, 20 (4): 235- 248.
doi: 10.1038/s41576-018-0092-0 |
5 |
PENG X Q , LUO H Z , KONG X Y , et al. Metrics for evaluating differentially methylated region sets predicted from BS-seq data[J]. Brief Bioinform, 2022, 23 (1): bbab475.
doi: 10.1093/bib/bbab475 |
6 |
MCEWEN K R , FERGUSON-SMITH A C . Distinguishing epigenetic marks of developmental and imprinting regulation[J]. Epigenetics Chromatin, 2010, 3 (1): 2.
doi: 10.1186/1756-8935-3-2 |
7 |
ARNAUD P . Genomic imprinting in germ cells: imprints are under control[J]. Reproduction, 2010, 140 (3): 411- 423.
doi: 10.1530/REP-10-0173 |
8 |
ZALETAEV D V , NEMTSOVA M V , STRELNIKOV V V . Epigenetic regulation disturbances on gene expression in imprinting diseases[J]. Mol Biol (Mosk), 2022, 56 (1): 1- 28.
doi: 10.1134/S0026893321050149 |
9 |
LUO X M , ZHANG T J , ZHAI Y X , et al. Effects of DNA methylation on TFs in human embryonic stem cells[J]. Front Genet, 2021, 12, 639461.
doi: 10.3389/fgene.2021.639461 |
10 |
STEINHOFF C , PAULSEN M , KIELBASA S , et al. Expression profile and transcription factor binding site exploration of imprinted genes in human and mouse[J]. BMC Genomics, 2009, 10, 144.
doi: 10.1186/1471-2164-10-144 |
11 |
ECKHARDT F , LEWIN J , CORTESE R , et al. DNA methylation profiling of human chromosomes 6, 20 and 22[J]. Nat Genet, 2006, 38 (12): 1378- 1385.
doi: 10.1038/ng1909 |
12 |
SINGH A , RAPPOLEE D A , RUDEN D M . Epigenetic reprogramming in Mice and Humans: from fertilization to primordial germ cell development[J]. Cells, 2023, 12 (14): 1874.
doi: 10.3390/cells12141874 |
13 |
FANIS P , MORROU M , TOMAZOU M , et al. Methylation status of hypothalamic Mkrn3 promoter across puberty[J]. Front Endocrinol (Lausanne), 2023, 13, 1075341.
doi: 10.3389/fendo.2022.1075341 |
14 | LI J L , CHEN W N , LI D J , et al. Conservation of imprinting and methylation of MKRN3, MAGEL2 and NDN genes in cattle[J]. Animals (Basel), 2021, 11 (7): 1985. |
15 | 张永杰. 多浪羊MKRN3、NDN、MAGEL2基因的印记和甲基化状态分析[D]. 阿拉尔市: 塔里木大学, 2023. |
ZHANG Y J. Analysis of imprinting and methylation status of MKRN3, NDN and MAGEL2 genes in Dolomite sheep[D]. Alaer: Tarim University, 2023. (in Chinese) | |
16 |
LI C Y , LU W L , YANG L G , et al. MKRN3 regulates the epigenetic switch of mammalian puberty via ubiquitination of MBD3[J]. Natl Sci Rev, 2020, 7 (3): 671- 685.
doi: 10.1093/nsr/nwaa023 |
17 |
LI C Y , HAN T T , LI Q R , et al. MKRN3-mediated ubiquitination of Poly(A)-binding proteins modulates the stability and translation of GNRH1 mRNA in mammalian puberty[J]. Nucleic Acids Res, 2021, 49 (7): 3796- 3813.
doi: 10.1093/nar/gkab155 |
18 |
KARAMI K , ZEREHDARAN S , JAVADMANESH A . Differential expression of RNAseq imprinted genes from bovine females before and after puberty[J]. Biochem Genet, 2023, 61 (6): 2633- 2649.
doi: 10.1007/s10528-023-10395-9 |
19 |
NIEMANN H , TIAN X C , KING W A , et al. Epigenetic reprogramming in embryonic and foetal development upon somatic cell nuclear transfer cloning[J]. Reproduction, 2008, 135 (2): 151- 163.
doi: 10.1530/REP-07-0397 |
20 |
RUAN D G , PENG J Y , WANG X S , et al. XIST derepression in active X chromosome hinders pig somatic cell nuclear transfer[J]. Stem Cell Rep, 2018, 10 (2): 494- 508.
doi: 10.1016/j.stemcr.2017.12.015 |
21 |
OKAE H , MATOBA S , NAGASHIMA T , et al. RNA sequencing-based identification of aberrant imprinting in cloned mice[J]. Hum Mol Genet, 2014, 23 (4): 992- 1001.
doi: 10.1093/hmg/ddt495 |
22 |
LIAO Z D , ZHANG J X , SUN S Y , et al. Reprogramming mechanism dissection and trophoblast replacement application in monkey somatic cell nuclear transfer[J]. Nat Commun, 2024, 15 (1): 5.
doi: 10.1038/s41467-023-43985-7 |
23 |
LI J L , YU D W , WANG J , et al. Identification of the porcine IG-DMR and abnormal imprinting of DLK1-DIO3 in cloned pigs[J]. Front Cell Dev Biol, 2022, 10, 964045.
doi: 10.3389/fcell.2022.964045 |
24 | ZAITOUN I , KHATIB H . Assessment of genomic imprinting of SLC38A4, NNAT, NAP1L5, and H19 in cattle[J]. BMC Genet, 2006, 7, 49. |
25 |
KADIFE E , HARPER A , DE ALWIS N , et al. SLC38A4 amino acid transporter expression is significantly lower in early preterm intrauterine growth restriction complicated placentas[J]. Int J Mol Sci, 2022, 24 (1): 403.
doi: 10.3390/ijms24010403 |
26 |
XIE Z , ZHANG W , ZHANG Y . Loss of Slc38a4 imprinting is a major cause of mouse placenta hyperplasia in somatic cell nuclear transferred embryos at late gestation[J]. Cell Rep, 2022, 38 (8): 110407.
doi: 10.1016/j.celrep.2022.110407 |
27 |
HALUŠKOVÁ J , HOLEČKOVÁ B , STANIČOVÁ J . DNA methylation studies in cattle[J]. J Appl Genet, 2021, 62 (1): 121- 136.
doi: 10.1007/s13353-020-00604-1 |
28 |
IWASAKI Y , AKSU C , REYES M , et al. The long-range interaction between two GNAS imprinting control regions delineates pseudohypoparathyroidism type 1B pathogenesis[J]. J Clin Invest, 2023, 133 (8): e167953.
doi: 10.1172/JCI167953 |
29 |
LAU J C , HANEL M L , WEVRICK R . Tissue-specific and imprinted epigenetic modifications of the human NDN gene[J]. Nucleic Acids Res, 2004, 32 (11): 3376- 3382.
doi: 10.1093/nar/gkh671 |
30 |
BARLOW D P , BARTOLOMEI M S . Genomic imprinting in mammals[J]. Cold Spring Harb Perspect Biol, 2014, 6 (2): a018382.
doi: 10.1101/cshperspect.a018382 |
31 |
LIANG D , AYGVN N , MATOBA N , et al. Inference of putative cell-type-specific imprinted regulatory elements and genes during human neuronal differentiation[J]. Hum Mol Genet, 2023, 32 (3): 402- 416.
doi: 10.1093/hmg/ddac207 |
32 |
JOZI M , JAFARPOUR F , MORADI R , et al. Induced DNA hypomethylation by folic acid deprivation in bovine fibroblast donor cells improves reprogramming of somatic cell nuclear transfer embryos[J]. Sci Rep, 2020, 10 (1): 5076.
doi: 10.1038/s41598-020-61797-3 |
33 |
GOLDKAMP A K , LI Y H , RIVERA R M , et al. Differentially expressed tRNA-derived fragments in bovine fetuses with assisted reproduction induced congenital overgrowth syndrome[J]. Front Genet, 2022, 13, 1055343.
doi: 10.3389/fgene.2022.1055343 |
34 |
VARGAS L N , CAIXETA F M C , DODE M A N , et al. DNA methylation profile of single in vitro matured bovine oocytes[J]. Mol Reprod Dev, 2023, 90 (4): 227- 235.
doi: 10.1002/mrd.23679 |
35 |
INOUE K , OGONUKI N , KAMIMURA S , et al. Loss of H3K27me3 imprinting in the Sfmbt2 miRNA cluster causes enlargement of cloned mouse placentas[J]. Nat Commun, 2020, 11 (1): 2150.
doi: 10.1038/s41467-020-16044-8 |
36 |
CHU C , ZHANG W H , KANG Y , et al. Analysis of developmental imprinting dynamics in primates using SNP-free methods to identify imprinting defects in cloned placenta[J]. Dev Cell, 2021, 56 (20): 2826- 2840.e7.
doi: 10.1016/j.devcel.2021.09.012 |
[1] | Liguo GAO, Hanqin SHEN, Yiquan CHEN, Sheng CHEN, Wencheng LIN, Feng CHEN. Prokaryotic Expression of Recombinant VP6* Protein of Porcine Rotavirus and Establishment of Indirect ELISA Detection Method [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(9): 4021-4028. |
[2] | PENG Ning, LIANG Yaxu, LONG Fei, YU Dongming, ZHONG Xiang. Inhibitory Effect of Resveratrol on Rotavirus-infected Porcine Intestinal Epithelial Cells IPEC-J2 [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(9): 4213-4225. |
[3] | Zhentao XIA, Nan WANG, Wanjie WANG, Qilü ZHOU, Lei HUANG, Yulian MU. Characteristics Analysis of TGEV Infection Mediated by IPEC-J2 with Knockout of pAPN Gene [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(8): 3395-3407. |
[4] | Yi WANG, Juan GAO, Yuemin HU, Yuefei YANG, Bojun FAN, Huiming JU. Effect of Transient Serum Starvation on Metabolism and Autophagy of Porcine Skeletal Muscle Satellite Cells [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(8): 3408-3417. |
[5] | Lindan LÜ, Hao MU, Xia HU, Mingni LIU, Shaomei LI, Xing LI, Zhenhui SONG, Liu YANG. Establishment and Preliminary Application of RAA Assay for the Detection of Porcine Transmissible Gastroenteritis Virus based on S Gene [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(8): 3590-3599. |
[6] | Weizhe LIU, Chenggang LUO, Rong YUAN, Yijie LIAO, Yimin WEN, Ying SUN, Enbo YU, Sanjie CAO, Xiaobo HUANG. Isolation and Identification of a Highly Pathogenic Strain of Porcine Epidemic Diarrhea Virus [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(7): 3049-3063. |
[7] | Jinting LUO, Fafang XU, Lei WANG, Xuan LUO, Yuhong MA, Jianbo ZHANG, Weihua HUANG, Yuejun SHANG, Guofang WU. The Effect of RSP on Cell Proliferation and Apoptosis of Porcine Leydig Cells with Hypoxia [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2441-2450. |
[8] | Dongliang LI, Guanmin ZHENG, Shuai LI, Hongsen ZHU, Chao WU. Differential Expression of Transcriptome in Jejunal of Piglets Infected with Porcine Epidemic Diarrhea Virus [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2652-2661. |
[9] | Shuqi XIAO, Jun LIU, Yingtong FENG, Yang LI, Lele XU. Effect of Antimicrobial Use in the Perinatal Period on the Performance of Sows and Piglets in PRRSV-positive Farms [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(6): 2751-2760. |
[10] | ZHANG Wei, PAN Zhihao, FANG Fugui. Advances in Epigenetic Regulation of the Onset of Puberty in Female Animals [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(5): 1875-1882. |
[11] | HAN Yang, GUAN Shuaiyin, LI Zhen, ZHOU Saisai, YUAN Honggen, SONG Yunfeng. Prokaryotic Expression and Protein Activity of Porcine Circovirus Type 3 Rep [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(5): 2061-2071. |
[12] | MA Rumeng, ZHAO Yuliang, MA Mingshuang, GUO Guihai, LIU Xinzi, LI Jiaxuan, CUI Wen, JIANG Yanping, SHAN Zhifu, ZHOU Han, WANG Li, QIAO Xinyuan, TANG Lijie, WANG Xiaona, LI Yijing. Comparative Study on the Immune Response Induced by the Different Porcine Receptor Bacteria with Expressing the Protective Antigen S1 of Porcine Epidemic Diarrhea Virus [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(5): 2090-2099. |
[13] | WANG Jing, ZHANG Shujuan, HU Xia, LIU Xiangyang, ZHANG Xingcui, SONG Zhenhui. CD44 Regulates Na+/H+ Exchanger 3 Activity by Influencing Porcine Epidemic Diarrhea Virus Replication [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(5): 2176-2185. |
[14] | HU Zeqi, LI Runcheng, TAN Zuming, XIE Xiuyan, WANG Jiangping, QIN Lejuan, LI Rong, GE Meng. Establishment and Preliminary Application of PEDV, PoRVA and PDCoV TaqMan Triple RT-qPCR Assay [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(5): 2267-2272. |
[15] | LAN Xinrui, ZHAO Baobao, ZHANG Bihan, LIN Xiaoyu, MA Huiming, WANG Yongsheng. Effects of β-sitosterol on Porcine Oocyte Maturation and Embryonic Development in Vitro [J]. Acta Veterinaria et Zootechnica Sinica, 2024, 55(4): 1629-1637. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||